image


Statistics

Number of enzymes: 1
Total Number of designed primers: 10
Number of PGTM primers:     4
Number of PMTM primers:     6
Number of Failed designed PMTM primers: 1

Enzyme Id:  K22013
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   108192640     NCBI Gene Symbol: LOC108192640
Gene Aliases DCAR_031492
Gene description & Other designations Description:   protein STAY-GREEN LIKE; chloroplastic-like      Other designations:   protein STAY-GREEN LIKE; chloroplastic-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 108192640
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (TCTCCA)2gttagagacttcaagc(CTT)6
Repeat start & end within CDS Repeat start: 34     Repeat end: 79
Forward primer Primer sequence:   TGGCTAATCATTGTTGTGCTCA     Tm(°C): 58.58     GC (%): 40.909     Size: 22
Reverse primer Primer sequence:   CTTGCTGGAGGACCCAAGAG     Tm(°C): 60.036     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 1     End: 172     Product size (bp): 172
JBrowse View      JBrowse

Enzyme Id:  K22013
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   108192640     NCBI Gene Symbol: LOC108192640
Gene Aliases DCAR_031492
Gene description & Other designations Description:   protein STAY-GREEN LIKE; chloroplastic-like      Other designations:   protein STAY-GREEN LIKE; chloroplastic-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 108192640
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   ATGATGTGGTGGCTCAGTGG     Tm(°C): 60.035     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TTGCCGCCAATAAACTGTGC     Tm(°C): 60.039     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 343     End: 666     Product size (bp): 324
JBrowse View      JBrowse

Enzyme Id:  K22013
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   108205944     NCBI Gene Symbol: LOC108205944
Gene Aliases DCAR_000893
Gene description & Other designations Description:   protein STAY-GREEN; chloroplastic-like      Other designations:   protein STAY-GREEN; chloroplastic-like
Chromosome, Strand & Exon count Chromosome:   1     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_030381.1      Gene Start and end within genomic accession: 5478398 ...... 5481030
CDS Sequence 108205944
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (GAGTG)2ctggggtccgctcatcgaggcagctgcaccatctagtggat(TCAGA
G)2
Repeat start & end within CDS Repeat start: 584     Repeat end: 646
Forward primer Primer sequence:   CGAAAGAGCTCCCTGTGGTT     Tm(°C): 59.965     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GGGCCATGGGATTGAACTCA     Tm(°C): 60.033     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 457     End: 749     Product size (bp): 293
JBrowse View      JBrowse

Enzyme Id:  K22013
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   108205944     NCBI Gene Symbol: LOC108205944
Gene Aliases DCAR_000893
Gene description & Other designations Description:   protein STAY-GREEN; chloroplastic-like      Other designations:   protein STAY-GREEN; chloroplastic-like
Chromosome, Strand & Exon count Chromosome:   1     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_030381.1      Gene Start and end within genomic accession: 5478398 ...... 5481030
CDS Sequence 108205944
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (GAGCA)2
Repeat start & end within CDS Repeat start: 772     Repeat end: 781
Forward primer Primer sequence:   CGAAAGAGCTCCCTGTGGTT     Tm(°C): 59.965     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GCAAGCTCTGAATCGCCTCA     Tm(°C): 60.742     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 457     End: 804     Product size (bp): 348
JBrowse View      JBrowse

Enzyme Id:  K22013
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   108205944     NCBI Gene Symbol: LOC108205944
Gene Aliases DCAR_000893
Gene description & Other designations Description:   protein STAY-GREEN; chloroplastic-like      Other designations:   protein STAY-GREEN; chloroplastic-like
Chromosome, Strand & Exon count Chromosome:   1     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_030381.1      Gene Start and end within genomic accession: 5478398 ...... 5481030
CDS Sequence 108205944
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (TTCTCT)2
Repeat start & end within CDS Repeat start: 21     Repeat end: 32
Forward primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Reverse primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Primer start, end within sequence and product size Start:      End:      Product size (bp):
JBrowse View      JBrowse

Enzyme Id:  K22013
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   108205944     NCBI Gene Symbol: LOC108205944
Gene Aliases DCAR_000893
Gene description & Other designations Description:   protein STAY-GREEN; chloroplastic-like      Other designations:   protein STAY-GREEN; chloroplastic-like
Chromosome, Strand & Exon count Chromosome:   1     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_030381.1      Gene Start and end within genomic accession: 5478398 ...... 5481030
CDS Sequence 108205944
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   CATTGTCACATAAGCGGCGG     Tm(°C): 59.972     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GGGCCATGGGATTGAACTCA     Tm(°C): 60.033     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 390     End: 749     Product size (bp): 360
JBrowse View      JBrowse

Enzyme Id:  K22013
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   108206688     NCBI Gene Symbol: LOC108206688
Gene Aliases DCAR_008432
Gene description & Other designations Description:   protein STAY-GREEN; chloroplastic-like      Other designations:   protein STAY-GREEN; chloroplastic-like
Chromosome, Strand & Exon count Chromosome:   2     Strand:   plus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_030382.1      Gene Start and end within genomic accession: 42101482 ...... 42103369
CDS Sequence 108206688
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (AGAGT)2
Repeat start & end within CDS Repeat start: 574     Repeat end: 583
Forward primer Primer sequence:   TCACATAAGCGGTGGCCATT     Tm(°C): 60.035     GC (%): 50     Size: 20
Reverse primer Primer sequence:   TCCTCTTGTTTCTGGTCGGC     Tm(°C): 59.965     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 386     End: 652     Product size (bp): 267
JBrowse View      JBrowse

Enzyme Id:  K22013
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   108206688     NCBI Gene Symbol: LOC108206688
Gene Aliases DCAR_008432
Gene description & Other designations Description:   protein STAY-GREEN; chloroplastic-like      Other designations:   protein STAY-GREEN; chloroplastic-like
Chromosome, Strand & Exon count Chromosome:   2     Strand:   plus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_030382.1      Gene Start and end within genomic accession: 42101482 ...... 42103369
CDS Sequence 108206688
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (AGAAG)2
Repeat start & end within CDS Repeat start: 654     Repeat end: 663
Forward primer Primer sequence:   GCCGACCAGAAACAAGAGGA     Tm(°C): 59.965     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GAACTCATGGTCGGGAAGCA     Tm(°C): 60.036     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 633     End: 751     Product size (bp): 119
JBrowse View      JBrowse

Enzyme Id:  K22013
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   108206688     NCBI Gene Symbol: LOC108206688
Gene Aliases DCAR_008432
Gene description & Other designations Description:   protein STAY-GREEN; chloroplastic-like      Other designations:   protein STAY-GREEN; chloroplastic-like
Chromosome, Strand & Exon count Chromosome:   2     Strand:   plus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_030382.1      Gene Start and end within genomic accession: 42101482 ...... 42103369
CDS Sequence 108206688
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (GATTGT)2
Repeat start & end within CDS Repeat start: 721     Repeat end: 732
Forward primer Primer sequence:   GCCGACCAGAAACAAGAGGA     Tm(°C): 59.965     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TGAACTCATGGTCGGGAAGC     Tm(°C): 60.036     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 633     End: 752     Product size (bp): 120
JBrowse View      JBrowse

Enzyme Id:  K22013
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   108206688     NCBI Gene Symbol: LOC108206688
Gene Aliases DCAR_008432
Gene description & Other designations Description:   protein STAY-GREEN; chloroplastic-like      Other designations:   protein STAY-GREEN; chloroplastic-like
Chromosome, Strand & Exon count Chromosome:   2     Strand:   plus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_030382.1      Gene Start and end within genomic accession: 42101482 ...... 42103369
CDS Sequence 108206688
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   TCACATAAGCGGTGGCCATT     Tm(°C): 60.035     GC (%): 50     Size: 20
Reverse primer Primer sequence:   TCCTCTTGTTTCTGGTCGGC     Tm(°C): 59.965     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 386     End: 652     Product size (bp): 267
JBrowse View      JBrowse

Enzyme Id:  K22013
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   108216602     NCBI Gene Symbol: LOC108216602
Gene Aliases
Gene description & Other designations Description:   protein STAY-GREEN LIKE; chloroplastic-like      Other designations:   protein STAY-GREEN LIKE; chloroplastic-like
Chromosome, Strand & Exon count Chromosome:   4     Strand:   plus     Exon count:   5
Gene Location within genomic sequence Genomic accession No. NC_030384.1      Gene Start and end within genomic accession: 22187824 ...... 22189471
CDS Sequence 108216602
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   TGCATGGGGACTCAGCATTT     Tm(°C): 59.96     GC (%): 50     Size: 20
Reverse primer Primer sequence:   TCGTCTTTCCTGTGCAGCAT     Tm(°C): 59.965     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 499     End: 638     Product size (bp): 140
JBrowse View      JBrowse