Enzyme Id: K20600 |
||||||||||||||||||||||||||||||||||||||||||||||||
| Gene Information | ||||||||||||||||||||||||||||||||||||||||||||||||
| NCBI Gene Accession Number & Symbol | Accession Number: 111460099 NCBI Gene Symbol: LOC111460099 | |||||||||||||||||||||||||||||||||||||||||||||||
| Gene Aliases | ||||||||||||||||||||||||||||||||||||||||||||||||
| Gene description & Other designations | Description: mitogen-activated protein kinase homolog MMK2-like Other designations: mitogen-activated protein kinase homolog MMK2-like | |||||||||||||||||||||||||||||||||||||||||||||||
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: | |||||||||||||||||||||||||||||||||||||||||||||||
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... | |||||||||||||||||||||||||||||||||||||||||||||||
| CDS Sequence | 111460099 | |||||||||||||||||||||||||||||||||||||||||||||||
| Marker Information | ||||||||||||||||||||||||||||||||||||||||||||||||
| Marker Type | PGTM | |||||||||||||||||||||||||||||||||||||||||||||||
| Repeat type & sequence | Repeat type: Repeat sequence: | |||||||||||||||||||||||||||||||||||||||||||||||
| Repeat start & end within CDS | Repeat start: Repeat end: | |||||||||||||||||||||||||||||||||||||||||||||||
| Forward primer | Primer sequence: GCCTGTTGGAAGAGGAGCTT Tm(°C): 59.963 GC (%): 55 Size: 20 | |||||||||||||||||||||||||||||||||||||||||||||||
| Reverse primer | Primer sequence: TGCAAGCCCAAAGTCTCCAA Tm(°C): 60.106 GC (%): 50 Size: 20 | |||||||||||||||||||||||||||||||||||||||||||||||
| Primer start, end within sequence and product size | Start: 122 End: 554 Product size (bp): 433 | |||||||||||||||||||||||||||||||||||||||||||||||
| JBrowse View | JBrowse | |||||||||||||||||||||||||||||||||||||||||||||||
Enzyme Id: K20600 |
||
| Gene Information | ||
| NCBI Gene Accession Number & Symbol | Accession Number: 111464556 NCBI Gene Symbol: LOC111464556 | |
| Gene Aliases | ||
| Gene description & Other designations | Description: mitogen-activated protein kinase homolog MMK2-like Other designations: mitogen-activated protein kinase homolog MMK2-like | |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: | |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... | |
| CDS Sequence | 111464556 | |
| Marker Information | ||
| Marker Type | PGTM | |
| Repeat type & sequence | Repeat type: Repeat sequence: | |
| Repeat start & end within CDS | Repeat start: Repeat end: | |
| Forward primer | Primer sequence: CTCGAGCCTCGGGTTCTTAC Tm(°C): 59.899 GC (%): 60 Size: 20 | |
| Reverse primer | Primer sequence: TCGGACATACTGGCTCCTCA Tm(°C): 60.034 GC (%): 55 Size: 20 | |
| Primer start, end within sequence and product size | Start: 776 End: 1008 Product size (bp): 233 | |
| JBrowse View | JBrowse | |