image


Statistics

Number of enzymes: 1
Total Number of designed primers: 12
Number of PGTM primers:     1
Number of PMTM primers:     11

Enzyme Id:  K19073
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   108201616     NCBI Gene Symbol: LOC108201616
Gene Aliases DCAR_030558
Gene description & Other designations Description:   divinyl chlorophyllide a 8-vinyl-reductase; chloroplastic      Other designations:   divinyl chlorophyllide a 8-vinyl-reductase; chloroplastic
Chromosome, Strand & Exon count Chromosome:   9     Strand:   minus     Exon count:   2
Gene Location within genomic sequence Genomic accession No. NC_030389.1      Gene Start and end within genomic accession: 27157303 ...... 27158403
CDS Sequence 108201616
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (TAGTT)2gctgggaagaagtatggggcttcaca(TTTTG)2
Repeat start & end within CDS Repeat start: 57     Repeat end: 102
Forward primer Primer sequence:   TGATTACGAGGCCACGAAGA     Tm(°C): 58.821     GC (%): 50     Size: 20
Reverse primer Primer sequence:   GGCTTCCCATCCTTCACCAA     Tm(°C): 59.96     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 35     End: 280     Product size (bp): 246
JBrowse View      JBrowse

Enzyme Id:  K19073
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   108201616     NCBI Gene Symbol: LOC108201616
Gene Aliases DCAR_030558
Gene description & Other designations Description:   divinyl chlorophyllide a 8-vinyl-reductase; chloroplastic      Other designations:   divinyl chlorophyllide a 8-vinyl-reductase; chloroplastic
Chromosome, Strand & Exon count Chromosome:   9     Strand:   minus     Exon count:   2
Gene Location within genomic sequence Genomic accession No. NC_030389.1      Gene Start and end within genomic accession: 27157303 ...... 27158403
CDS Sequence 108201616
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GGA)3
Repeat start & end within CDS Repeat start: 186     Repeat end: 194
Forward primer Primer sequence:   CCGCTTCTTGAGTTTCAGCG     Tm(°C): 59.835     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCTTCCCAGGTCCACCAATC     Tm(°C): 60.034     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 126     End: 417     Product size (bp): 292
JBrowse View      JBrowse

Enzyme Id:  K19073
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   108201616     NCBI Gene Symbol: LOC108201616
Gene Aliases DCAR_030558
Gene description & Other designations Description:   divinyl chlorophyllide a 8-vinyl-reductase; chloroplastic      Other designations:   divinyl chlorophyllide a 8-vinyl-reductase; chloroplastic
Chromosome, Strand & Exon count Chromosome:   9     Strand:   minus     Exon count:   2
Gene Location within genomic sequence Genomic accession No. NC_030389.1      Gene Start and end within genomic accession: 27157303 ...... 27158403
CDS Sequence 108201616
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (AAGAT)2
Repeat start & end within CDS Repeat start: 374     Repeat end: 383
Forward primer Primer sequence:   TTGGTGAAGGATGGGAAGCC     Tm(°C): 59.96     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCTTCCCAGGTCCACCAATC     Tm(°C): 60.034     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 261     End: 417     Product size (bp): 157
JBrowse View      JBrowse

Enzyme Id:  K19073
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   108201616     NCBI Gene Symbol: LOC108201616
Gene Aliases DCAR_030558
Gene description & Other designations Description:   divinyl chlorophyllide a 8-vinyl-reductase; chloroplastic      Other designations:   divinyl chlorophyllide a 8-vinyl-reductase; chloroplastic
Chromosome, Strand & Exon count Chromosome:   9     Strand:   minus     Exon count:   2
Gene Location within genomic sequence Genomic accession No. NC_030389.1      Gene Start and end within genomic accession: 27157303 ...... 27158403
CDS Sequence 108201616
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (TGGAA)2
Repeat start & end within CDS Repeat start: 549     Repeat end: 558
Forward primer Primer sequence:   GATTGGTGGACCTGGGAAGG     Tm(°C): 60.034     GC (%): 60     Size: 20
Reverse primer Primer sequence:   CCCCCAATTCCTGACCAGAC     Tm(°C): 60.034     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 398     End: 732     Product size (bp): 335
JBrowse View      JBrowse

Enzyme Id:  K19073
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   108201616     NCBI Gene Symbol: LOC108201616
Gene Aliases DCAR_030558
Gene description & Other designations Description:   divinyl chlorophyllide a 8-vinyl-reductase; chloroplastic      Other designations:   divinyl chlorophyllide a 8-vinyl-reductase; chloroplastic
Chromosome, Strand & Exon count Chromosome:   9     Strand:   minus     Exon count:   2
Gene Location within genomic sequence Genomic accession No. NC_030389.1      Gene Start and end within genomic accession: 27157303 ...... 27158403
CDS Sequence 108201616
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   GATTGGTGGACCTGGGAAGG     Tm(°C): 60.034     GC (%): 60     Size: 20
Reverse primer Primer sequence:   CCCCCAATTCCTGACCAGAC     Tm(°C): 60.034     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 398     End: 732     Product size (bp): 335
JBrowse View      JBrowse

Enzyme Id:  K19073
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   108203180     NCBI Gene Symbol: LOC108203180
Gene Aliases DCAR_030562
Gene description & Other designations Description:   divinyl chlorophyllide a 8-vinyl-reductase; chloroplastic      Other designations:   divinyl chlorophyllide a 8-vinyl-reductase; chloroplastic
Chromosome, Strand & Exon count Chromosome:   9     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_030389.1      Gene Start and end within genomic accession: 27435603 ...... 27438038
CDS Sequence 108203180
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (TTAAGC)2
Repeat start & end within CDS Repeat start: 164     Repeat end: 175
Forward primer Primer sequence:   ATTCGCCCAAAGCTCAAAGC     Tm(°C): 59.755     GC (%): 50     Size: 20
Reverse primer Primer sequence:   AATATACCCGGTGGACCCCA     Tm(°C): 60.03     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 37     End: 281     Product size (bp): 245
JBrowse View      JBrowse

Enzyme Id:  K19073
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   108203180     NCBI Gene Symbol: LOC108203180
Gene Aliases DCAR_030562
Gene description & Other designations Description:   divinyl chlorophyllide a 8-vinyl-reductase; chloroplastic      Other designations:   divinyl chlorophyllide a 8-vinyl-reductase; chloroplastic
Chromosome, Strand & Exon count Chromosome:   9     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_030389.1      Gene Start and end within genomic accession: 27435603 ...... 27438038
CDS Sequence 108203180
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Di     Repeat sequence: (GA)4
Repeat start & end within CDS Repeat start: 339     Repeat end: 346
Forward primer Primer sequence:   TGGGGTCCACCGGGTATATT     Tm(°C): 60.03     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AGAATCTTTAACCCCGCCCG     Tm(°C): 60.107     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 262     End: 527     Product size (bp): 266
JBrowse View      JBrowse

Enzyme Id:  K19073
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   108203180     NCBI Gene Symbol: LOC108203180
Gene Aliases DCAR_030562
Gene description & Other designations Description:   divinyl chlorophyllide a 8-vinyl-reductase; chloroplastic      Other designations:   divinyl chlorophyllide a 8-vinyl-reductase; chloroplastic
Chromosome, Strand & Exon count Chromosome:   9     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_030389.1      Gene Start and end within genomic accession: 27435603 ...... 27438038
CDS Sequence 108203180
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (TCTTG)2
Repeat start & end within CDS Repeat start: 490     Repeat end: 499
Forward primer Primer sequence:   TGGGGTCCACCGGGTATATT     Tm(°C): 60.03     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AGAATCTTTAACCCCGCCCG     Tm(°C): 60.107     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 262     End: 527     Product size (bp): 266
JBrowse View      JBrowse

Enzyme Id:  K19073
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   108203180     NCBI Gene Symbol: LOC108203180
Gene Aliases DCAR_030562
Gene description & Other designations Description:   divinyl chlorophyllide a 8-vinyl-reductase; chloroplastic      Other designations:   divinyl chlorophyllide a 8-vinyl-reductase; chloroplastic
Chromosome, Strand & Exon count Chromosome:   9     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_030389.1      Gene Start and end within genomic accession: 27435603 ...... 27438038
CDS Sequence 108203180
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (TAGTT)2gctgggaagaagtatggggcttcaca(TTTTG)2
Repeat start & end within CDS Repeat start: 558     Repeat end: 603
Forward primer Primer sequence:   CGGGCGGGGTTAAAGATTCT     Tm(°C): 60.107     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GGCTTCCCATCCTTCACCAA     Tm(°C): 59.96     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 508     End: 781     Product size (bp): 274
JBrowse View      JBrowse

Enzyme Id:  K19073
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   108203180     NCBI Gene Symbol: LOC108203180
Gene Aliases DCAR_030562
Gene description & Other designations Description:   divinyl chlorophyllide a 8-vinyl-reductase; chloroplastic      Other designations:   divinyl chlorophyllide a 8-vinyl-reductase; chloroplastic
Chromosome, Strand & Exon count Chromosome:   9     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_030389.1      Gene Start and end within genomic accession: 27435603 ...... 27438038
CDS Sequence 108203180
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GGA)3
Repeat start & end within CDS Repeat start: 687     Repeat end: 695
Forward primer Primer sequence:   CGGGCGGGGTTAAAGATTCT     Tm(°C): 60.107     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GGCTTCCCATCCTTCACCAA     Tm(°C): 59.96     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 508     End: 781     Product size (bp): 274
JBrowse View      JBrowse

Enzyme Id:  K19073
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   108203180     NCBI Gene Symbol: LOC108203180
Gene Aliases DCAR_030562
Gene description & Other designations Description:   divinyl chlorophyllide a 8-vinyl-reductase; chloroplastic      Other designations:   divinyl chlorophyllide a 8-vinyl-reductase; chloroplastic
Chromosome, Strand & Exon count Chromosome:   9     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_030389.1      Gene Start and end within genomic accession: 27435603 ...... 27438038
CDS Sequence 108203180
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (AAGAT)2
Repeat start & end within CDS Repeat start: 875     Repeat end: 884
Forward primer Primer sequence:   TTGGTGAAGGATGGGAAGCC     Tm(°C): 59.96     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCTTCCCAGGTCCACCAATC     Tm(°C): 60.034     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 762     End: 918     Product size (bp): 157
JBrowse View      JBrowse

Enzyme Id:  K19073
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   108203180     NCBI Gene Symbol: LOC108203180
Gene Aliases DCAR_030562
Gene description & Other designations Description:   divinyl chlorophyllide a 8-vinyl-reductase; chloroplastic      Other designations:   divinyl chlorophyllide a 8-vinyl-reductase; chloroplastic
Chromosome, Strand & Exon count Chromosome:   9     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_030389.1      Gene Start and end within genomic accession: 27435603 ...... 27438038
CDS Sequence 108203180
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (TGGAA)2
Repeat start & end within CDS Repeat start: 1050     Repeat end: 1059
Forward primer Primer sequence:   GATTGGTGGACCTGGGAAGG     Tm(°C): 60.034     GC (%): 60     Size: 20
Reverse primer Primer sequence:   CCCAATTCCTGACCAGCCAT     Tm(°C): 60.033     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 899     End: 1231     Product size (bp): 333
JBrowse View      JBrowse