Statistics
Number of enzymes: 1
Total Number of designed primers: 2
Number of PGTM primers: 1
Number of PMTM primers: 1
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101247061 NCBI Gene Symbol: LOC101247061 |
| Gene Aliases | |
| Gene description & Other designations | Description: divinyl chlorophyllide a 8-vinyl-reductase; chloroplastic Other designations: divinyl chlorophyllide a 8-vinyl-reductase; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: 1 Strand: plus Exon count: 2 |
| Gene Location within genomic sequence | Genomic accession No. NC_015438.3 Gene Start and end within genomic accession: 75531394 ...... 75534814 |
| CDS Sequence | 101247061 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Compound Repeat sequence: (TGT)3(TGTCT)2* |
| Repeat start & end within CDS | Repeat start: 492 Repeat end: 509 |
| Forward primer | Primer sequence: GCCTCTACTGTCGAAACCCC Tm(°C): 60.108 GC (%): 60 Size: 20 |
| Reverse primer | Primer sequence: ACCCCACCATTTCGACTAGC Tm(°C): 59.748 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 204 End: 529 Product size (bp): 326 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101247061 NCBI Gene Symbol: LOC101247061 |
| Gene Aliases | |
| Gene description & Other designations | Description: divinyl chlorophyllide a 8-vinyl-reductase; chloroplastic Other designations: divinyl chlorophyllide a 8-vinyl-reductase; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: 1 Strand: plus Exon count: 2 |
| Gene Location within genomic sequence | Genomic accession No. NC_015438.3 Gene Start and end within genomic accession: 75531394 ...... 75534814 |
| CDS Sequence | 101247061 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: AGCTGAAATTCGAGGCGGAA Tm(°C): 60.036 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: TGTCAATGCCTTCCCAGGTC Tm(°C): 59.962 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 664 End: 938 Product size (bp): 275 |
| JBrowse View | JBrowse |
