image


Statistics

Number of enzymes: 1
Total Number of designed primers: 14
Number of PGTM primers:     4
Number of PMTM primers:     10
Number of Failed designed PMTM primers: 1

Enzyme Id:  K18881
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103327328     NCBI Gene Symbol: LOC103327328
Gene Aliases
Gene description & Other designations Description:   protein DJ-1 homolog D-like      Other designations:   protein DJ-1 homolog D-like
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   minus     Exon count:   7
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 814336 ...... 858049
CDS Sequence 103327328
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GCT)3
Repeat start & end within CDS Repeat start: 964     Repeat end: 972
Forward primer Primer sequence:   TCTGTGCAACTGCTGTCCAT     Tm(°C): 59.891     GC (%): 50     Size: 20
Reverse primer Primer sequence:   AGCCATGTTGCTCCTGACAA     Tm(°C): 59.889     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 721     End: 1048     Product size (bp): 328
JBrowse View      JBrowse

Enzyme Id:  K18881
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103327328     NCBI Gene Symbol: LOC103327328
Gene Aliases
Gene description & Other designations Description:   protein DJ-1 homolog D-like      Other designations:   protein DJ-1 homolog D-like
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   minus     Exon count:   7
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 814336 ...... 858049
CDS Sequence 103327328
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   GGAAGACTACGAGGCGATGG     Tm(°C): 59.969     GC (%): 60     Size: 20
Reverse primer Primer sequence:   TGCCCGTCCTCCTGGTATTA     Tm(°C): 60.032     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 47     End: 281     Product size (bp): 235
JBrowse View      JBrowse

Enzyme Id:  K18881
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103327330     NCBI Gene Symbol: LOC103327330
Gene Aliases
Gene description & Other designations Description:   protein DJ-1 homolog D-like      Other designations:   protein DJ-1 homolog D-like
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 850562 ...... 852600
CDS Sequence 103327330
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (GT)4tgctgatga(TAATT)2
Repeat start & end within CDS Repeat start: 508     Repeat end: 534
Forward primer Primer sequence:   GGTGCTCACTGGGTAGAACC     Tm(°C): 60.036     GC (%): 60     Size: 20
Reverse primer Primer sequence:   AGCAGTTGGGCAGGTATCAC     Tm(°C): 60.035     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 474     End: 752     Product size (bp): 279
JBrowse View      JBrowse

Enzyme Id:  K18881
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103327330     NCBI Gene Symbol: LOC103327330
Gene Aliases
Gene description & Other designations Description:   protein DJ-1 homolog D-like      Other designations:   protein DJ-1 homolog D-like
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 850562 ...... 852600
CDS Sequence 103327330
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (TCA)3
Repeat start & end within CDS Repeat start: 626     Repeat end: 634
Forward primer Primer sequence:   GGTGCTCACTGGGTAGAACC     Tm(°C): 60.036     GC (%): 60     Size: 20
Reverse primer Primer sequence:   AGCAGTTGGGCAGGTATCAC     Tm(°C): 60.035     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 474     End: 752     Product size (bp): 279
JBrowse View      JBrowse

Enzyme Id:  K18881
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103327330     NCBI Gene Symbol: LOC103327330
Gene Aliases
Gene description & Other designations Description:   protein DJ-1 homolog D-like      Other designations:   protein DJ-1 homolog D-like
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 850562 ...... 852600
CDS Sequence 103327330
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GGA)3
Repeat start & end within CDS Repeat start: 26     Repeat end: 34
Forward primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Reverse primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Primer start, end within sequence and product size Start:      End:      Product size (bp):
JBrowse View      JBrowse

Enzyme Id:  K18881
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103327330     NCBI Gene Symbol: LOC103327330
Gene Aliases
Gene description & Other designations Description:   protein DJ-1 homolog D-like      Other designations:   protein DJ-1 homolog D-like
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 850562 ...... 852600
CDS Sequence 103327330
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   GGTGCTCACTGGGTAGAACC     Tm(°C): 60.036     GC (%): 60     Size: 20
Reverse primer Primer sequence:   AGCAGTTGGGCAGGTATCAC     Tm(°C): 60.035     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 474     End: 752     Product size (bp): 279
JBrowse View      JBrowse

Enzyme Id:  K18881
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103327332     NCBI Gene Symbol: LOC103327332
Gene Aliases
Gene description & Other designations Description:   protein DJ-1 homolog D-like      Other designations:   protein DJ-1 homolog D-like
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 824634 ...... 826712
CDS Sequence 103327332
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (GT)4tgctgatga(TAATT)2
Repeat start & end within CDS Repeat start: 505     Repeat end: 531
Forward primer Primer sequence:   GGTGCTCACTGGGTAGAACC     Tm(°C): 60.036     GC (%): 60     Size: 20
Reverse primer Primer sequence:   AGCAGTTGGGCAGGTATCAC     Tm(°C): 60.035     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 471     End: 749     Product size (bp): 279
JBrowse View      JBrowse

Enzyme Id:  K18881
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103327332     NCBI Gene Symbol: LOC103327332
Gene Aliases
Gene description & Other designations Description:   protein DJ-1 homolog D-like      Other designations:   protein DJ-1 homolog D-like
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 824634 ...... 826712
CDS Sequence 103327332
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (TCA)3
Repeat start & end within CDS Repeat start: 623     Repeat end: 631
Forward primer Primer sequence:   GGTGCTCACTGGGTAGAACC     Tm(°C): 60.036     GC (%): 60     Size: 20
Reverse primer Primer sequence:   AGCAGTTGGGCAGGTATCAC     Tm(°C): 60.035     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 471     End: 749     Product size (bp): 279
JBrowse View      JBrowse

Enzyme Id:  K18881
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103327332     NCBI Gene Symbol: LOC103327332
Gene Aliases
Gene description & Other designations Description:   protein DJ-1 homolog D-like      Other designations:   protein DJ-1 homolog D-like
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 824634 ...... 826712
CDS Sequence 103327332
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   GTGATACCTGCCCAACTGCT     Tm(°C): 60.035     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TTCCATCAGCGACACAACGA     Tm(°C): 59.967     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 730     End: 1101     Product size (bp): 372
JBrowse View      JBrowse

Enzyme Id:  K18881
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103327333     NCBI Gene Symbol: LOC103327333
Gene Aliases
Gene description & Other designations Description:   protein DJ-1 homolog D-like      Other designations:   protein DJ-1 homolog D-like
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 805168 ...... 807460
CDS Sequence 103327333
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (GT)4tgctgatga(TAATT)2
Repeat start & end within CDS Repeat start: 505     Repeat end: 531
Forward primer Primer sequence:   GGTGCTCACTGGGTAGAACC     Tm(°C): 60.036     GC (%): 60     Size: 20
Reverse primer Primer sequence:   AGCAGTTGGGCAGGTATCAC     Tm(°C): 60.035     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 471     End: 749     Product size (bp): 279
JBrowse View      JBrowse

Enzyme Id:  K18881
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103327333     NCBI Gene Symbol: LOC103327333
Gene Aliases
Gene description & Other designations Description:   protein DJ-1 homolog D-like      Other designations:   protein DJ-1 homolog D-like
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 805168 ...... 807460
CDS Sequence 103327333
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (TCA)3
Repeat start & end within CDS Repeat start: 623     Repeat end: 631
Forward primer Primer sequence:   GGTGCTCACTGGGTAGAACC     Tm(°C): 60.036     GC (%): 60     Size: 20
Reverse primer Primer sequence:   AGCAGTTGGGCAGGTATCAC     Tm(°C): 60.035     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 471     End: 749     Product size (bp): 279
JBrowse View      JBrowse

Enzyme Id:  K18881
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103327424     NCBI Gene Symbol: LOC103327424
Gene Aliases
Gene description & Other designations Description:   protein DJ-1 homolog D-like      Other designations:   LOW QUALITY PROTEIN: protein DJ-1 homolog D-like
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   plus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 1555572 ...... 1560352
CDS Sequence 103327424
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GCT)3
Repeat start & end within CDS Repeat start: 964     Repeat end: 972
Forward primer Primer sequence:   ACTGTGGAAGCCAGGAAACC     Tm(°C): 60.179     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TTCCATCCGTGAAGCAACGA     Tm(°C): 59.966     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 909     End: 1077     Product size (bp): 169
JBrowse View      JBrowse

Enzyme Id:  K18881
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103327481     NCBI Gene Symbol: LOC103327481
Gene Aliases
Gene description & Other designations Description:   protein DJ-1 homolog D-like      Other designations:   protein DJ-1 homolog D-like
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 865355 ...... 868381
CDS Sequence 103327481
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GCT)3
Repeat start & end within CDS Repeat start: 823     Repeat end: 831
Forward primer Primer sequence:   CTACAGTGAGAAGCCAGGCC     Tm(°C): 60.108     GC (%): 60     Size: 20
Reverse primer Primer sequence:   GTTGCTCCCGACAAAACCAC     Tm(°C): 59.97     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 620     End: 895     Product size (bp): 276
JBrowse View      JBrowse

Enzyme Id:  K18881
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103327481     NCBI Gene Symbol: LOC103327481
Gene Aliases
Gene description & Other designations Description:   protein DJ-1 homolog D-like      Other designations:   protein DJ-1 homolog D-like
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 865355 ...... 868381
CDS Sequence 103327481
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (GGCCA)2
Repeat start & end within CDS Repeat start: 962     Repeat end: 971
Forward primer Primer sequence:   GTGGTTTTGTCGGGAGCAAC     Tm(°C): 59.97     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GCAATGCCATCAGTTGCGAA     Tm(°C): 60.109     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 876     End: 1002     Product size (bp): 127
JBrowse View      JBrowse

Enzyme Id:  K18881
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103327481     NCBI Gene Symbol: LOC103327481
Gene Aliases
Gene description & Other designations Description:   protein DJ-1 homolog D-like      Other designations:   protein DJ-1 homolog D-like
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 865355 ...... 868381
CDS Sequence 103327481
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   TCTGAATCACGCGGTCACAA     Tm(°C): 59.967     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CTGCTAAGACCAACTGCCCA     Tm(°C): 59.963     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 45     End: 246     Product size (bp): 202
JBrowse View      JBrowse