image


Statistics

Number of enzymes: 1
Total Number of designed primers: 30
Number of PGTM primers:     4
Number of PMTM primers:     26
Number of Failed designed PMTM primers: 2

Enzyme Id:  K18835
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111434299     NCBI Gene Symbol: LOC111434299
Gene Aliases
Gene description & Other designations Description:   probable WRKY transcription factor 2      Other designations:   probable WRKY transcription factor 2
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111434299
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (TGA)3
Repeat start & end within CDS Repeat start: 39     Repeat end: 47
Forward primer Primer sequence:   GGTCTATGGCGAGCACAGAG     Tm(°C): 60.249     GC (%): 60     Size: 20
Reverse primer Primer sequence:   CCCCGTTGTTGGAGATGGAA     Tm(°C): 59.962     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 5     End: 263     Product size (bp): 259
JBrowse View      JBrowse

Enzyme Id:  K18835
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111434299     NCBI Gene Symbol: LOC111434299
Gene Aliases
Gene description & Other designations Description:   probable WRKY transcription factor 2      Other designations:   probable WRKY transcription factor 2
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111434299
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (CCG)3
Repeat start & end within CDS Repeat start: 604     Repeat end: 612
Forward primer Primer sequence:   TCAGGAAGGCGAAACGGATC     Tm(°C): 60.108     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TCACCTGTTTCTGGCCGTAC     Tm(°C): 59.966     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 395     End: 708     Product size (bp): 314
JBrowse View      JBrowse

Enzyme Id:  K18835
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111434299     NCBI Gene Symbol: LOC111434299
Gene Aliases
Gene description & Other designations Description:   probable WRKY transcription factor 2      Other designations:   probable WRKY transcription factor 2
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111434299
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (AAG)3gtggagcgatcgcttgacggtcagatcacagagat(TA)4
Repeat start & end within CDS Repeat start: 766     Repeat end: 817
Forward primer Primer sequence:   GTACGGCCAGAAACAGGTGA     Tm(°C): 59.966     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCCATCAACGCTCCAATCCT     Tm(°C): 60.107     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 689     End: 992     Product size (bp): 304
JBrowse View      JBrowse

Enzyme Id:  K18835
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111434299     NCBI Gene Symbol: LOC111434299
Gene Aliases
Gene description & Other designations Description:   probable WRKY transcription factor 2      Other designations:   probable WRKY transcription factor 2
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111434299
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (ATG)3acga(CGG)5aggaa(GCG)3gtggaaac(GAT)3
Repeat start & end within CDS Repeat start: 1112     Repeat end: 1170
Forward primer Primer sequence:   AGGATTGGAGCGTTGATGGG     Tm(°C): 60.107     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ACCCAAGCTTGTCTCCATGG     Tm(°C): 59.961     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 973     End: 1265     Product size (bp): 293
JBrowse View      JBrowse

Enzyme Id:  K18835
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111434299     NCBI Gene Symbol: LOC111434299
Gene Aliases
Gene description & Other designations Description:   probable WRKY transcription factor 2      Other designations:   probable WRKY transcription factor 2
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111434299
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (AGT)3
Repeat start & end within CDS Repeat start: 1290     Repeat end: 1298
Forward primer Primer sequence:   AGCTGATGATGCAGAGCCTG     Tm(°C): 60.179     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TCATGCGATGCTCTCTCGAC     Tm(°C): 59.97     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1196     End: 1453     Product size (bp): 258
JBrowse View      JBrowse

Enzyme Id:  K18835
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111434299     NCBI Gene Symbol: LOC111434299
Gene Aliases
Gene description & Other designations Description:   probable WRKY transcription factor 2      Other designations:   probable WRKY transcription factor 2
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111434299
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (CAG)6t(AGC)4accgcgcaagcctcct(CTG)4ctactca(GGC)4
Repeat start & end within CDS Repeat start: 1518     Repeat end: 1595
Forward primer Primer sequence:   GTCGAGAGAGCATCGCATGA     Tm(°C): 59.97     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ATGGGGAAGTCCAAAGCAGG     Tm(°C): 59.96     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1434     End: 1762     Product size (bp): 329
JBrowse View      JBrowse

Enzyme Id:  K18835
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111434299     NCBI Gene Symbol: LOC111434299
Gene Aliases
Gene description & Other designations Description:   probable WRKY transcription factor 2      Other designations:   probable WRKY transcription factor 2
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111434299
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (TCT)3
Repeat start & end within CDS Repeat start: 1897     Repeat end: 1905
Forward primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Reverse primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Primer start, end within sequence and product size Start:      End:      Product size (bp):
JBrowse View      JBrowse

Enzyme Id:  K18835
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111434299     NCBI Gene Symbol: LOC111434299
Gene Aliases
Gene description & Other designations Description:   probable WRKY transcription factor 2      Other designations:   probable WRKY transcription factor 2
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111434299
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   GTCGAGAGAGCATCGCATGA     Tm(°C): 59.97     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ATGGGGAAGTCCAAAGCAGG     Tm(°C): 59.96     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1434     End: 1762     Product size (bp): 329
JBrowse View      JBrowse

Enzyme Id:  K18835
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111438723     NCBI Gene Symbol: LOC111438723
Gene Aliases
Gene description & Other designations Description:   probable WRKY transcription factor 2      Other designations:   probable WRKY transcription factor 2
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111438723
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (CGGTA)2
Repeat start & end within CDS Repeat start: 252     Repeat end: 261
Forward primer Primer sequence:   GATCCCGGGTGTCAACTCTG     Tm(°C): 60.108     GC (%): 60     Size: 20
Reverse primer Primer sequence:   TCGATTGTTCGCCTCCAACA     Tm(°C): 59.966     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 212     End: 536     Product size (bp): 325
JBrowse View      JBrowse

Enzyme Id:  K18835
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111438723     NCBI Gene Symbol: LOC111438723
Gene Aliases
Gene description & Other designations Description:   probable WRKY transcription factor 2      Other designations:   probable WRKY transcription factor 2
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111438723
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (GAAGT)2
Repeat start & end within CDS Repeat start: 361     Repeat end: 370
Forward primer Primer sequence:   GATCCCGGGTGTCAACTCTG     Tm(°C): 60.108     GC (%): 60     Size: 20
Reverse primer Primer sequence:   TCGATTGTTCGCCTCCAACA     Tm(°C): 59.966     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 212     End: 536     Product size (bp): 325
JBrowse View      JBrowse

Enzyme Id:  K18835
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111438723     NCBI Gene Symbol: LOC111438723
Gene Aliases
Gene description & Other designations Description:   probable WRKY transcription factor 2      Other designations:   probable WRKY transcription factor 2
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111438723
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (ATC)3
Repeat start & end within CDS Repeat start: 719     Repeat end: 727
Forward primer Primer sequence:   GCTTTCAGACCGAGGTTGGA     Tm(°C): 59.965     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TCATCCGGTTGCTCATCGAG     Tm(°C): 59.897     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 576     End: 865     Product size (bp): 290
JBrowse View      JBrowse

Enzyme Id:  K18835
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111438723     NCBI Gene Symbol: LOC111438723
Gene Aliases
Gene description & Other designations Description:   probable WRKY transcription factor 2      Other designations:   probable WRKY transcription factor 2
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111438723
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GTG)6
Repeat start & end within CDS Repeat start: 815     Repeat end: 832
Forward primer Primer sequence:   GCTTTCAGACCGAGGTTGGA     Tm(°C): 59.965     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TCATCCGGTTGCTCATCGAG     Tm(°C): 59.897     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 576     End: 865     Product size (bp): 290
JBrowse View      JBrowse

Enzyme Id:  K18835
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111438723     NCBI Gene Symbol: LOC111438723
Gene Aliases
Gene description & Other designations Description:   probable WRKY transcription factor 2      Other designations:   probable WRKY transcription factor 2
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111438723
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (AAG)3
Repeat start & end within CDS Repeat start: 1024     Repeat end: 1032
Forward primer Primer sequence:   CTCGATGAGCAACCGGATGA     Tm(°C): 59.897     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TCTGATGCTCGTCGATTCGG     Tm(°C): 59.971     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 846     End: 1123     Product size (bp): 278
JBrowse View      JBrowse

Enzyme Id:  K18835
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111438723     NCBI Gene Symbol: LOC111438723
Gene Aliases
Gene description & Other designations Description:   probable WRKY transcription factor 2      Other designations:   probable WRKY transcription factor 2
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111438723
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (GATGAA)2
Repeat start & end within CDS Repeat start: 1330     Repeat end: 1341
Forward primer Primer sequence:   CCGAATCGACGAGCATCAGA     Tm(°C): 59.971     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GGCGTCGAGTTTCCTCTTCT     Tm(°C): 59.756     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1104     End: 1427     Product size (bp): 324
JBrowse View      JBrowse

Enzyme Id:  K18835
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111438723     NCBI Gene Symbol: LOC111438723
Gene Aliases
Gene description & Other designations Description:   probable WRKY transcription factor 2      Other designations:   probable WRKY transcription factor 2
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111438723
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GTT)3
Repeat start & end within CDS Repeat start: 1477     Repeat end: 1485
Forward primer Primer sequence:   ACGGAAATGAGTGGGGCTAC     Tm(°C): 59.748     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GCATGATGAGTAGCGGTCGA     Tm(°C): 59.969     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1434     End: 1771     Product size (bp): 338
JBrowse View      JBrowse

Enzyme Id:  K18835
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111438723     NCBI Gene Symbol: LOC111438723
Gene Aliases
Gene description & Other designations Description:   probable WRKY transcription factor 2      Other designations:   probable WRKY transcription factor 2
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111438723
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (TCCAG)2
Repeat start & end within CDS Repeat start: 1729     Repeat end: 1738
Forward primer Primer sequence:   GGACAGAAGGTGGTGAAGGG     Tm(°C): 59.963     GC (%): 60     Size: 20
Reverse primer Primer sequence:   GCATGATGAGTAGCGGTCGA     Tm(°C): 59.969     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1539     End: 1771     Product size (bp): 233
JBrowse View      JBrowse

Enzyme Id:  K18835
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111438723     NCBI Gene Symbol: LOC111438723
Gene Aliases
Gene description & Other designations Description:   probable WRKY transcription factor 2      Other designations:   probable WRKY transcription factor 2
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111438723
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (TGCCCA)2tggc(TTTGGT)2atgaaccaacctggactgagaaatctaaacc(T
GACCA)2tggcatcagctggt(CAAGC)2ttcctgttctaccaatgcatccatac
tt(AGCACA)2caatgttcatgaaatgggt(TTG)3
Repeat start & end within CDS Repeat start: 1863     Repeat end: 2025
Forward primer Primer sequence:   CCTTGCTGGAAGACAACCGA     Tm(°C): 60.25     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TCACATCTCAGGCCCAAGTG     Tm(°C): 59.674     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1835     End: 2138     Product size (bp): 304
JBrowse View      JBrowse

Enzyme Id:  K18835
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111438723     NCBI Gene Symbol: LOC111438723
Gene Aliases
Gene description & Other designations Description:   probable WRKY transcription factor 2      Other designations:   probable WRKY transcription factor 2
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111438723
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   CGAGAACACACGGTGTCTGA     Tm(°C): 59.97     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TCGATTGTTCGCCTCCAACA     Tm(°C): 59.966     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 171     End: 536     Product size (bp): 366
JBrowse View      JBrowse

Enzyme Id:  K18835
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111453084     NCBI Gene Symbol: LOC111453084
Gene Aliases
Gene description & Other designations Description:   probable WRKY transcription factor 2      Other designations:   probable WRKY transcription factor 2
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111453084
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (ATG)3
Repeat start & end within CDS Repeat start: 517     Repeat end: 525
Forward primer Primer sequence:   AGTTCCCGTTCTTGCCGAAT     Tm(°C): 59.964     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CGCATGACGTAGAGAGTCCC     Tm(°C): 59.97     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 478     End: 798     Product size (bp): 321
JBrowse View      JBrowse

Enzyme Id:  K18835
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111453084     NCBI Gene Symbol: LOC111453084
Gene Aliases
Gene description & Other designations Description:   probable WRKY transcription factor 2      Other designations:   probable WRKY transcription factor 2
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111453084
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (GA)4tgatgtgggtaagaccgtgtcagatgatcaaagaacctttgattctttgt
(GTG)4
Repeat start & end within CDS Repeat start: 802     Repeat end: 871
Forward primer Primer sequence:   TCCGCAAGTGGGACTCTCTA     Tm(°C): 59.961     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GCCTCTTTGCTCCCCTTCAT     Tm(°C): 60.034     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 770     End: 920     Product size (bp): 151
JBrowse View      JBrowse

Enzyme Id:  K18835
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111453084     NCBI Gene Symbol: LOC111453084
Gene Aliases
Gene description & Other designations Description:   probable WRKY transcription factor 2      Other designations:   probable WRKY transcription factor 2
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111453084
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (TGG)3
Repeat start & end within CDS Repeat start: 939     Repeat end: 947
Forward primer Primer sequence:   ATGAAGGGGAGCAAAGAGGC     Tm(°C): 60.034     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GGCCACCTTGTGCAGAAATG     Tm(°C): 60.038     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 901     End: 1218     Product size (bp): 318
JBrowse View      JBrowse

Enzyme Id:  K18835
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111453084     NCBI Gene Symbol: LOC111453084
Gene Aliases
Gene description & Other designations Description:   probable WRKY transcription factor 2      Other designations:   probable WRKY transcription factor 2
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111453084
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (GATGAA)2
Repeat start & end within CDS Repeat start: 1426     Repeat end: 1437
Forward primer Primer sequence:   GGAGCTCCTGATTGGATGCA     Tm(°C): 59.818     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CGACAACTCTAGGCTCACGG     Tm(°C): 60.179     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 1272     End: 1578     Product size (bp): 307
JBrowse View      JBrowse

Enzyme Id:  K18835
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111453084     NCBI Gene Symbol: LOC111453084
Gene Aliases
Gene description & Other designations Description:   probable WRKY transcription factor 2      Other designations:   probable WRKY transcription factor 2
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111453084
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (TGAGTC)2
Repeat start & end within CDS Repeat start: 1491     Repeat end: 1502
Forward primer Primer sequence:   GGAGCTCCTGATTGGATGCA     Tm(°C): 59.818     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CGACAACTCTAGGCTCACGG     Tm(°C): 60.179     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 1272     End: 1578     Product size (bp): 307
JBrowse View      JBrowse

Enzyme Id:  K18835
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111453084     NCBI Gene Symbol: LOC111453084
Gene Aliases
Gene description & Other designations Description:   probable WRKY transcription factor 2      Other designations:   probable WRKY transcription factor 2
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111453084
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (AAATCC)2
Repeat start & end within CDS Repeat start: 1656     Repeat end: 1667
Forward primer Primer sequence:   GCTATCGCTGGCGCAAATAC     Tm(°C): 60.111     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ACTGCCCATCTGCTGTCTTC     Tm(°C): 60.036     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1615     End: 1964     Product size (bp): 350
JBrowse View      JBrowse

Enzyme Id:  K18835
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111453084     NCBI Gene Symbol: LOC111453084
Gene Aliases
Gene description & Other designations Description:   probable WRKY transcription factor 2      Other designations:   probable WRKY transcription factor 2
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111453084
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (TCCAG)2
Repeat start & end within CDS Repeat start: 1825     Repeat end: 1834
Forward primer Primer sequence:   AGTGAGGAAGCATGTCGAGC     Tm(°C): 60.108     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ACTGCCCATCTGCTGTCTTC     Tm(°C): 60.036     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1703     End: 1964     Product size (bp): 262
JBrowse View      JBrowse

Enzyme Id:  K18835
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111453084     NCBI Gene Symbol: LOC111453084
Gene Aliases
Gene description & Other designations Description:   probable WRKY transcription factor 2      Other designations:   probable WRKY transcription factor 2
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111453084
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (GCCAA)2gcttcctgttctgccaatgcatccatactt(AGCACA)2
Repeat start & end within CDS Repeat start: 2030     Repeat end: 2081
Forward primer Primer sequence:   GAAGACAGCAGATGGGCAGT     Tm(°C): 60.036     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TTGGGCTCTCCTTTTGGCAA     Tm(°C): 60.106     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 1945     End: 2125     Product size (bp): 181
JBrowse View      JBrowse

Enzyme Id:  K18835
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111453084     NCBI Gene Symbol: LOC111453084
Gene Aliases
Gene description & Other designations Description:   probable WRKY transcription factor 2      Other designations:   probable WRKY transcription factor 2
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111453084
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   AGGCAGCGTCAATCCATTCA     Tm(°C): 60.035     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CGCATGACGTAGAGAGTCCC     Tm(°C): 59.97     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 542     End: 798     Product size (bp): 257
JBrowse View      JBrowse

Enzyme Id:  K18835
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111461729     NCBI Gene Symbol: LOC111461729
Gene Aliases
Gene description & Other designations Description:   WRKY transcription factor SUSIBA2-like      Other designations:   WRKY transcription factor SUSIBA2-like|probable WRKY transcription factor 34
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111461729
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (AAG)3
Repeat start & end within CDS Repeat start: 874     Repeat end: 882
Forward primer Primer sequence:   AGATGACAGTGAGACGCAGC     Tm(°C): 60.109     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CAAGCATGGCTCGACGATTG     Tm(°C): 59.973     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 695     End: 975     Product size (bp): 281
JBrowse View      JBrowse

Enzyme Id:  K18835
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111461729     NCBI Gene Symbol: LOC111461729
Gene Aliases
Gene description & Other designations Description:   WRKY transcription factor SUSIBA2-like      Other designations:   WRKY transcription factor SUSIBA2-like|probable WRKY transcription factor 34
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111461729
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (ATG)4gcggcggtggtgga(GAT)4
Repeat start & end within CDS Repeat start: 1247     Repeat end: 1284
Forward primer Primer sequence:   AAGTTGAAGCTGGGCTGACA     Tm(°C): 59.817     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CCACCCTCTTTTCGCCTTCT     Tm(°C): 59.963     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1036     End: 1366     Product size (bp): 331
JBrowse View      JBrowse

Enzyme Id:  K18835
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111461729     NCBI Gene Symbol: LOC111461729
Gene Aliases
Gene description & Other designations Description:   WRKY transcription factor SUSIBA2-like      Other designations:   WRKY transcription factor SUSIBA2-like|probable WRKY transcription factor 34
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111461729
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (AAATCC)2
Repeat start & end within CDS Repeat start: 1497     Repeat end: 1508
Forward primer Primer sequence:   AGAAGGCGAAAAGAGGGTGG     Tm(°C): 59.963     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CTGCCATTTCTTGCTGCAGG     Tm(°C): 60.109     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1347     End: 1645     Product size (bp): 299
JBrowse View      JBrowse

Enzyme Id:  K18835
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111461729     NCBI Gene Symbol: LOC111461729
Gene Aliases
Gene description & Other designations Description:   WRKY transcription factor SUSIBA2-like      Other designations:   WRKY transcription factor SUSIBA2-like|probable WRKY transcription factor 34
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111461729
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (TCA)3
Repeat start & end within CDS Repeat start: 2182     Repeat end: 2190
Forward primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Reverse primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Primer start, end within sequence and product size Start:      End:      Product size (bp):
JBrowse View      JBrowse

Enzyme Id:  K18835
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111461729     NCBI Gene Symbol: LOC111461729
Gene Aliases
Gene description & Other designations Description:   WRKY transcription factor SUSIBA2-like      Other designations:   WRKY transcription factor SUSIBA2-like|probable WRKY transcription factor 34
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111461729
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   CAATCGTCGAGCCATGCTTG     Tm(°C): 59.973     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCACCCTCTTTTCGCCTTCT     Tm(°C): 59.963     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 956     End: 1366     Product size (bp): 411
JBrowse View      JBrowse