Statistics
Number of enzymes: 1
Total Number of designed primers: 4
Number of PGTM primers: 1
Number of PMTM primers: 3
|
| Gene Information | |
NCBI Gene Accession Number & Symbol | Accession Number: 103335696 NCBI Gene Symbol: LOC103335696 |
Gene Aliases | |
Gene description & Other designations | Description: bifunctional phosphatase IMPL2; chloroplastic Other designations: bifunctional phosphatase IMPL2; chloroplastic |
Chromosome, Strand & Exon count | Chromosome: LG6 Strand: plus Exon count: 10 |
Gene Location within genomic sequence | Genomic accession No. NC_024131.1 Gene Start and end within genomic accession: 11510213 ...... 11515309 |
CDS Sequence | 103335696 |
| Marker Information | |
Marker Type | PMTM |
Repeat type & sequence | Repeat type: Compound Repeat sequence: (ATTCCC)2aatcccaccactccca(CCACTC)2tccgcttctcaactcccaagc
c(CTCACT)2cctccgcctcc(CT)4 |
Repeat start & end within CDS | Repeat start: 55 Repeat end: 147 |
Forward primer | Primer sequence: TCCCAAACCCCTCTCCTTCT Tm(°C): 59.804 GC (%): 55 Size: 20 |
Reverse primer | Primer sequence: ATCGGCTACCTTGTTGGCAA Tm(°C): 59.962 GC (%): 50 Size: 20 |
Primer start, end within sequence and product size | Start: 14 End: 266 Product size (bp): 253 |
JBrowse View | JBrowse |
|
| Gene Information | |
NCBI Gene Accession Number & Symbol | Accession Number: 103335696 NCBI Gene Symbol: LOC103335696 |
Gene Aliases | |
Gene description & Other designations | Description: bifunctional phosphatase IMPL2; chloroplastic Other designations: bifunctional phosphatase IMPL2; chloroplastic |
Chromosome, Strand & Exon count | Chromosome: LG6 Strand: plus Exon count: 10 |
Gene Location within genomic sequence | Genomic accession No. NC_024131.1 Gene Start and end within genomic accession: 11510213 ...... 11515309 |
CDS Sequence | 103335696 |
| Marker Information | |
Marker Type | PMTM |
Repeat type & sequence | Repeat type: Penta Repeat sequence: (GGAGA)2 |
Repeat start & end within CDS | Repeat start: 418 Repeat end: 427 |
Forward primer | Primer sequence: TTGCCAACAAGGTAGCCGAT Tm(°C): 59.962 GC (%): 50 Size: 20 |
Reverse primer | Primer sequence: AGCCTTCTCTTTGCACCTCC Tm(°C): 59.963 GC (%): 55 Size: 20 |
Primer start, end within sequence and product size | Start: 247 End: 452 Product size (bp): 206 |
JBrowse View | JBrowse |
|
| Gene Information | |
NCBI Gene Accession Number & Symbol | Accession Number: 103335696 NCBI Gene Symbol: LOC103335696 |
Gene Aliases | |
Gene description & Other designations | Description: bifunctional phosphatase IMPL2; chloroplastic Other designations: bifunctional phosphatase IMPL2; chloroplastic |
Chromosome, Strand & Exon count | Chromosome: LG6 Strand: plus Exon count: 10 |
Gene Location within genomic sequence | Genomic accession No. NC_024131.1 Gene Start and end within genomic accession: 11510213 ...... 11515309 |
CDS Sequence | 103335696 |
| Marker Information | |
Marker Type | PMTM |
Repeat type & sequence | Repeat type: Compound Repeat sequence: (CTATGC)2tcttctggcttctggttacgtggatc(TTG)3 |
Repeat start & end within CDS | Repeat start: 780 Repeat end: 826 |
Forward primer | Primer sequence: CTATTCAGCGCAGAGGCAGA Tm(°C): 59.896 GC (%): 55 Size: 20 |
Reverse primer | Primer sequence: TCTCCAGCTGCCACTACATT Tm(°C): 58.721 GC (%): 50 Size: 20 |
Primer start, end within sequence and product size | Start: 702 End: 976 Product size (bp): 275 |
JBrowse View | JBrowse |
|
| Gene Information | |
NCBI Gene Accession Number & Symbol | Accession Number: 103335696 NCBI Gene Symbol: LOC103335696 |
Gene Aliases | |
Gene description & Other designations | Description: bifunctional phosphatase IMPL2; chloroplastic Other designations: bifunctional phosphatase IMPL2; chloroplastic |
Chromosome, Strand & Exon count | Chromosome: LG6 Strand: plus Exon count: 10 |
Gene Location within genomic sequence | Genomic accession No. NC_024131.1 Gene Start and end within genomic accession: 11510213 ...... 11515309 |
CDS Sequence | 103335696 |
| Marker Information | |
Marker Type | PGTM |
Repeat type & sequence | Repeat type: Repeat sequence: |
Repeat start & end within CDS | Repeat start: Repeat end: |
Forward primer | Primer sequence: GGAGGTGCAAAGAGAAGGCT Tm(°C): 59.963 GC (%): 55 Size: 20 |
Reverse primer | Primer sequence: CCTTCCACTCATCCCAACCC Tm(°C): 60.034 GC (%): 60 Size: 20 |
Primer start, end within sequence and product size | Start: 433 End: 617 Product size (bp): 185 |
JBrowse View | JBrowse |