image


Statistics

Number of enzymes: 1
Total Number of designed primers: 4
Number of PGTM primers:     1
Number of PMTM primers:     3

Enzyme Id:  K18649

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103335696     NCBI Gene Symbol: LOC103335696
Gene Aliases
Gene description & Other designations Description:   bifunctional phosphatase IMPL2; chloroplastic      Other designations:   bifunctional phosphatase IMPL2; chloroplastic
Chromosome, Strand & Exon count Chromosome:   LG6     Strand:   plus     Exon count:   10
Gene Location within genomic sequence Genomic accession No. NC_024131.1      Gene Start and end within genomic accession: 11510213 ...... 11515309
CDS Sequence 103335696
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (ATTCCC)2aatcccaccactccca(CCACTC)2tccgcttctcaactcccaagc
c(CTCACT)2cctccgcctcc(CT)4
Repeat start & end within CDS Repeat start: 55     Repeat end: 147
Forward primer Primer sequence:   TCCCAAACCCCTCTCCTTCT     Tm(°C): 59.804     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ATCGGCTACCTTGTTGGCAA     Tm(°C): 59.962     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 14     End: 266     Product size (bp): 253
JBrowse View      JBrowse

Enzyme Id:  K18649

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103335696     NCBI Gene Symbol: LOC103335696
Gene Aliases
Gene description & Other designations Description:   bifunctional phosphatase IMPL2; chloroplastic      Other designations:   bifunctional phosphatase IMPL2; chloroplastic
Chromosome, Strand & Exon count Chromosome:   LG6     Strand:   plus     Exon count:   10
Gene Location within genomic sequence Genomic accession No. NC_024131.1      Gene Start and end within genomic accession: 11510213 ...... 11515309
CDS Sequence 103335696
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (GGAGA)2
Repeat start & end within CDS Repeat start: 418     Repeat end: 427
Forward primer Primer sequence:   TTGCCAACAAGGTAGCCGAT     Tm(°C): 59.962     GC (%): 50     Size: 20
Reverse primer Primer sequence:   AGCCTTCTCTTTGCACCTCC     Tm(°C): 59.963     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 247     End: 452     Product size (bp): 206
JBrowse View      JBrowse

Enzyme Id:  K18649

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103335696     NCBI Gene Symbol: LOC103335696
Gene Aliases
Gene description & Other designations Description:   bifunctional phosphatase IMPL2; chloroplastic      Other designations:   bifunctional phosphatase IMPL2; chloroplastic
Chromosome, Strand & Exon count Chromosome:   LG6     Strand:   plus     Exon count:   10
Gene Location within genomic sequence Genomic accession No. NC_024131.1      Gene Start and end within genomic accession: 11510213 ...... 11515309
CDS Sequence 103335696
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (CTATGC)2tcttctggcttctggttacgtggatc(TTG)3
Repeat start & end within CDS Repeat start: 780     Repeat end: 826
Forward primer Primer sequence:   CTATTCAGCGCAGAGGCAGA     Tm(°C): 59.896     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TCTCCAGCTGCCACTACATT     Tm(°C): 58.721     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 702     End: 976     Product size (bp): 275
JBrowse View      JBrowse

Enzyme Id:  K18649

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103335696     NCBI Gene Symbol: LOC103335696
Gene Aliases
Gene description & Other designations Description:   bifunctional phosphatase IMPL2; chloroplastic      Other designations:   bifunctional phosphatase IMPL2; chloroplastic
Chromosome, Strand & Exon count Chromosome:   LG6     Strand:   plus     Exon count:   10
Gene Location within genomic sequence Genomic accession No. NC_024131.1      Gene Start and end within genomic accession: 11510213 ...... 11515309
CDS Sequence 103335696
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   GGAGGTGCAAAGAGAAGGCT     Tm(°C): 59.963     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCTTCCACTCATCCCAACCC     Tm(°C): 60.034     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 433     End: 617     Product size (bp): 185
JBrowse View      JBrowse