PlantPathMarks Database

Statistics

Number of enzymes: 1

Total Number of designed primers: 4

Number of PGTM primers: 3

Number of PMTM primers: 1

Number of Failed designed PMTM primers: 2

Enzyme Id: K17991
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 103318709 NCBI Gene Symbol: LOC103318709
Gene Aliases
Gene description & Other designations	Description: peroxygenase Other designations: peroxygenase
Chromosome, Strand & Exon count	Chromosome: LG1 Strand: plus Exon count: 6
Gene Location within genomic sequence	Genomic accession No. NC_024126.1 Gene Start and end within genomic accession: 25825145 ...... 25826719
CDS Sequence	103318709
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Hexa Repeat sequence: (TTTCAT)2
Repeat start & end within CDS	Repeat start: 300 Repeat end: 311
Forward primer	Primer sequence: AGGGCTATGACTGCTCCTGA Tm(°C): 60.032 GC (%): 55 Size: 20
Reverse primer	Primer sequence: TGCCCGGTGTATGTTTTCGA Tm(°C): 59.965 GC (%): 50 Size: 20
Primer start, end within sequence and product size	Start: 123 End: 404 Product size (bp): 282
JBrowse View	JBrowse

Enzyme Id: K17991
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 103318709 NCBI Gene Symbol: LOC103318709
Gene Aliases
Gene description & Other designations	Description: peroxygenase Other designations: peroxygenase
Chromosome, Strand & Exon count	Chromosome: LG1 Strand: plus Exon count: 6
Gene Location within genomic sequence	Genomic accession No. NC_024126.1 Gene Start and end within genomic accession: 25825145 ...... 25826719
CDS Sequence	103318709
	Marker Information
Marker Type	PGTM
Repeat type & sequence	Repeat type: Repeat sequence:
Repeat start & end within CDS	Repeat start: Repeat end:
Forward primer	Primer sequence: TCGAAAACATACACCGGGCA Tm(°C): 59.965 GC (%): 50 Size: 20
Reverse primer	Primer sequence: TCGAACAAGCTTCCGTCGAA Tm(°C): 59.969 GC (%): 50 Size: 20
Primer start, end within sequence and product size	Start: 385 End: 679 Product size (bp): 295
JBrowse View	JBrowse

Enzyme Id: K17991
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 103321432 NCBI Gene Symbol: LOC103321432
Gene Aliases
Gene description & Other designations	Description: probable peroxygenase 4 Other designations: probable peroxygenase 4
Chromosome, Strand & Exon count	Chromosome: LG2 Strand: minus Exon count: 6
Gene Location within genomic sequence	Genomic accession No. NC_024127.1 Gene Start and end within genomic accession: 16160203 ...... 16162770
CDS Sequence	103321432
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Tri Repeat sequence: (TTC)3
Repeat start & end within CDS	Repeat start: 6 Repeat end: 14
Forward primer	Primer sequence: None Tm(°C): GC (%): Size:
Reverse primer	Primer sequence: None Tm(°C): GC (%): Size:
Primer start, end within sequence and product size	Start: End: Product size (bp):
JBrowse View	JBrowse

Enzyme Id: K17991
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 103321432 NCBI Gene Symbol: LOC103321432
Gene Aliases
Gene description & Other designations	Description: probable peroxygenase 4 Other designations: probable peroxygenase 4
Chromosome, Strand & Exon count	Chromosome: LG2 Strand: minus Exon count: 6
Gene Location within genomic sequence	Genomic accession No. NC_024127.1 Gene Start and end within genomic accession: 16160203 ...... 16162770
CDS Sequence	103321432
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Hexa Repeat sequence: (GGAGAG)2
Repeat start & end within CDS	Repeat start: 549 Repeat end: 560
Forward primer	Primer sequence: None Tm(°C): GC (%): Size:
Reverse primer	Primer sequence: None Tm(°C): GC (%): Size:
Primer start, end within sequence and product size	Start: End: Product size (bp):
JBrowse View	JBrowse

Enzyme Id: K17991
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 103321432 NCBI Gene Symbol: LOC103321432
Gene Aliases
Gene description & Other designations	Description: probable peroxygenase 4 Other designations: probable peroxygenase 4
Chromosome, Strand & Exon count	Chromosome: LG2 Strand: minus Exon count: 6
Gene Location within genomic sequence	Genomic accession No. NC_024127.1 Gene Start and end within genomic accession: 16160203 ...... 16162770
CDS Sequence	103321432
	Marker Information
Marker Type	PGTM
Repeat type & sequence	Repeat type: Repeat sequence:
Repeat start & end within CDS	Repeat start: Repeat end:
Forward primer	Primer sequence: TTTCGTGCAATTGGCTGTGG Tm(°C): 59.968 GC (%): 50 Size: 20
Reverse primer	Primer sequence: CATAGACACCGGAGTCGCTC Tm(°C): 59.97 GC (%): 60 Size: 20
Primer start, end within sequence and product size	Start: 129 End: 294 Product size (bp): 166
JBrowse View	JBrowse

Enzyme Id: K17991
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 103323925 NCBI Gene Symbol: LOC103323925
Gene Aliases
Gene description & Other designations	Description: peroxygenase Other designations: peroxygenase
Chromosome, Strand & Exon count	Chromosome: LG2 Strand: plus Exon count: 6
Gene Location within genomic sequence	Genomic accession No. NC_024127.1 Gene Start and end within genomic accession: 39105792 ...... 39108075
CDS Sequence	103323925
	Marker Information
Marker Type	PGTM
Repeat type & sequence	Repeat type: Repeat sequence:
Repeat start & end within CDS	Repeat start: Repeat end:
Forward primer	Primer sequence: CAATCTCATCGCTGCCGTTG Tm(°C): 59.973 GC (%): 55 Size: 20
Reverse primer	Primer sequence: TCCATCAAAGCAGCGCCTAA Tm(°C): 60.036 GC (%): 50 Size: 20
Primer start, end within sequence and product size	Start: 278 End: 662 Product size (bp): 385
JBrowse View	JBrowse