image


Statistics

Number of enzymes: 1
Total Number of designed primers: 10
Number of PGTM primers:     2
Number of PMTM primers:     8

Enzyme Id:  K17839
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   109827207     NCBI Gene Symbol: LOC109827207
Gene Aliases A4U43_UnF1970
Gene description & Other designations Description:   probable polyamine oxidase 4      Other designations:   probable polyamine oxidase 4
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 109827207
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Di     Repeat sequence: (TC)4
Repeat start & end within CDS Repeat start: 54     Repeat end: 61
Forward primer Primer sequence:   TTCACCGGTTGCGACGATTT     Tm(°C): 60.881     GC (%): 50     Size: 20
Reverse primer Primer sequence:   GAAGCATTAGAAAGCGCCCG     Tm(°C): 59.972     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 15     End: 169     Product size (bp): 155
JBrowse View      JBrowse

Enzyme Id:  K17839
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   109827207     NCBI Gene Symbol: LOC109827207
Gene Aliases A4U43_UnF1970
Gene description & Other designations Description:   probable polyamine oxidase 4      Other designations:   probable polyamine oxidase 4
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 109827207
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (ATGACC)2
Repeat start & end within CDS Repeat start: 362     Repeat end: 373
Forward primer Primer sequence:   TCGACATGGGAGCATCATGG     Tm(°C): 59.893     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CTTCGTTTGCCAGACCCTCT     Tm(°C): 59.965     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 247     End: 576     Product size (bp): 330
JBrowse View      JBrowse

Enzyme Id:  K17839
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   109827207     NCBI Gene Symbol: LOC109827207
Gene Aliases A4U43_UnF1970
Gene description & Other designations Description:   probable polyamine oxidase 4      Other designations:   probable polyamine oxidase 4
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 109827207
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (GCCATT)2
Repeat start & end within CDS Repeat start: 517     Repeat end: 528
Forward primer Primer sequence:   TCGACATGGGAGCATCATGG     Tm(°C): 59.893     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CTTCGTTTGCCAGACCCTCT     Tm(°C): 59.965     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 247     End: 576     Product size (bp): 330
JBrowse View      JBrowse

Enzyme Id:  K17839
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   109827207     NCBI Gene Symbol: LOC109827207
Gene Aliases A4U43_UnF1970
Gene description & Other designations Description:   probable polyamine oxidase 4      Other designations:   probable polyamine oxidase 4
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 109827207
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (ACCGA)2
Repeat start & end within CDS Repeat start: 1177     Repeat end: 1186
Forward primer Primer sequence:   CATGGCTGCTGGAAGTTTCG     Tm(°C): 59.83     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ACACTCTTCGGCAGCATCAA     Tm(°C): 59.965     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 1076     End: 1391     Product size (bp): 316
JBrowse View      JBrowse

Enzyme Id:  K17839
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   109827207     NCBI Gene Symbol: LOC109827207
Gene Aliases A4U43_UnF1970
Gene description & Other designations Description:   probable polyamine oxidase 4      Other designations:   probable polyamine oxidase 4
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 109827207
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   CGGGCGCTTTCTAATGCTTC     Tm(°C): 59.972     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CTTCGTTTGCCAGACCCTCT     Tm(°C): 59.965     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 150     End: 576     Product size (bp): 427
JBrowse View      JBrowse

Enzyme Id:  K17839
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   109845387     NCBI Gene Symbol: LOC109845387
Gene Aliases A4U43_C06F18950
Gene description & Other designations Description:   probable polyamine oxidase 2      Other designations:   probable polyamine oxidase 2
Chromosome, Strand & Exon count Chromosome:   6     Strand:   plus     Exon count:   11
Gene Location within genomic sequence Genomic accession No. NC_033799.1      Gene Start and end within genomic accession: 74253957 ...... 74263187
CDS Sequence 109845387
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (GTTGT)2
Repeat start & end within CDS Repeat start: 157     Repeat end: 166
Forward primer Primer sequence:   GCTGCCCATGCACTTCAAAA     Tm(°C): 59.966     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CAGGGGAGCCAAGGGATTTT     Tm(°C): 59.958     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 123     End: 284     Product size (bp): 162
JBrowse View      JBrowse

Enzyme Id:  K17839
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   109845387     NCBI Gene Symbol: LOC109845387
Gene Aliases A4U43_C06F18950
Gene description & Other designations Description:   probable polyamine oxidase 2      Other designations:   probable polyamine oxidase 2
Chromosome, Strand & Exon count Chromosome:   6     Strand:   plus     Exon count:   11
Gene Location within genomic sequence Genomic accession No. NC_033799.1      Gene Start and end within genomic accession: 74253957 ...... 74263187
CDS Sequence 109845387
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (TCTGA)2
Repeat start & end within CDS Repeat start: 523     Repeat end: 532
Forward primer Primer sequence:   AAAATCCCTTGGCTCCCCTG     Tm(°C): 59.958     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCACCCTTCCATTCTGCACA     Tm(°C): 60.251     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 265     End: 590     Product size (bp): 326
JBrowse View      JBrowse

Enzyme Id:  K17839
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   109845387     NCBI Gene Symbol: LOC109845387
Gene Aliases A4U43_C06F18950
Gene description & Other designations Description:   probable polyamine oxidase 2      Other designations:   probable polyamine oxidase 2
Chromosome, Strand & Exon count Chromosome:   6     Strand:   plus     Exon count:   11
Gene Location within genomic sequence Genomic accession No. NC_033799.1      Gene Start and end within genomic accession: 74253957 ...... 74263187
CDS Sequence 109845387
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (TGCAGA)2
Repeat start & end within CDS Repeat start: 597     Repeat end: 608
Forward primer Primer sequence:   TGTGCAGAATGGAAGGGTGG     Tm(°C): 60.251     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GACCATGACCACCAGGAAGG     Tm(°C): 60.035     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 571     End: 663     Product size (bp): 93
JBrowse View      JBrowse

Enzyme Id:  K17839
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   109845387     NCBI Gene Symbol: LOC109845387
Gene Aliases A4U43_C06F18950
Gene description & Other designations Description:   probable polyamine oxidase 2      Other designations:   probable polyamine oxidase 2
Chromosome, Strand & Exon count Chromosome:   6     Strand:   plus     Exon count:   11
Gene Location within genomic sequence Genomic accession No. NC_033799.1      Gene Start and end within genomic accession: 74253957 ...... 74263187
CDS Sequence 109845387
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (ATTGC)2actttgacaaggttttttggccaaatgtagagttccttggagttgtc
(TCT)4
Repeat start & end within CDS Repeat start: 928     Repeat end: 996
Forward primer Primer sequence:   TGCAGATGCCGCTGTCATTA     Tm(°C): 60.108     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CAATGTCATGAGCAAGCCGG     Tm(°C): 59.9     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 800     End: 1086     Product size (bp): 287
JBrowse View      JBrowse

Enzyme Id:  K17839
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   109845387     NCBI Gene Symbol: LOC109845387
Gene Aliases A4U43_C06F18950
Gene description & Other designations Description:   probable polyamine oxidase 2      Other designations:   probable polyamine oxidase 2
Chromosome, Strand & Exon count Chromosome:   6     Strand:   plus     Exon count:   11
Gene Location within genomic sequence Genomic accession No. NC_033799.1      Gene Start and end within genomic accession: 74253957 ...... 74263187
CDS Sequence 109845387
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   ATGAGTGGCTGAGGATCCCT     Tm(°C): 60.03     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GCTTCTTCTCCCATGGCAGT     Tm(°C): 60.035     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1252     End: 1435     Product size (bp): 184
JBrowse View      JBrowse