image


Statistics

Number of enzymes: 1
Total Number of designed primers: 13
Number of PGTM primers:     2
Number of PMTM primers:     11

Enzyme Id:  K17108
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103318985     NCBI Gene Symbol: LOC103318985
Gene Aliases
Gene description & Other designations Description:   non-lysosomal glucosylceramidase      Other designations:   non-lysosomal glucosylceramidase
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   minus     Exon count:   20
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 781060 ...... 790460
CDS Sequence 103318985
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (GATTCT)2
Repeat start & end within CDS Repeat start: 52     Repeat end: 63
Forward primer Primer sequence:   TGGAGAATGGGTTTGTTGAAAG     Tm(°C): 57.065     GC (%): 40.909     Size: 22
Reverse primer Primer sequence:   CAGTTGCCAGCGCTGAAATT     Tm(°C): 60.039     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 19     End: 359     Product size (bp): 341
JBrowse View      JBrowse

Enzyme Id:  K17108
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103318985     NCBI Gene Symbol: LOC103318985
Gene Aliases
Gene description & Other designations Description:   non-lysosomal glucosylceramidase      Other designations:   non-lysosomal glucosylceramidase
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   minus     Exon count:   20
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 781060 ...... 790460
CDS Sequence 103318985
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (GGAAG)2
Repeat start & end within CDS Repeat start: 232     Repeat end: 241
Forward primer Primer sequence:   GTTGACCCTGGGAAGCCTAC     Tm(°C): 60.035     GC (%): 60     Size: 20
Reverse primer Primer sequence:   CAGTTGCCAGCGCTGAAATT     Tm(°C): 60.039     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 75     End: 359     Product size (bp): 285
JBrowse View      JBrowse

Enzyme Id:  K17108
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103318985     NCBI Gene Symbol: LOC103318985
Gene Aliases
Gene description & Other designations Description:   non-lysosomal glucosylceramidase      Other designations:   non-lysosomal glucosylceramidase
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   minus     Exon count:   20
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 781060 ...... 790460
CDS Sequence 103318985
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (TTCAA)2
Repeat start & end within CDS Repeat start: 778     Repeat end: 787
Forward primer Primer sequence:   AAAGACTGCAGCGGATGTCA     Tm(°C): 59.965     GC (%): 50     Size: 20
Reverse primer Primer sequence:   AAGGGCACTCTGACACATGG     Tm(°C): 59.963     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 698     End: 912     Product size (bp): 215
JBrowse View      JBrowse

Enzyme Id:  K17108
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103318985     NCBI Gene Symbol: LOC103318985
Gene Aliases
Gene description & Other designations Description:   non-lysosomal glucosylceramidase      Other designations:   non-lysosomal glucosylceramidase
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   minus     Exon count:   20
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 781060 ...... 790460
CDS Sequence 103318985
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GCA)3
Repeat start & end within CDS Repeat start: 1714     Repeat end: 1722
Forward primer Primer sequence:   AAGTTCACACGCCCATAGCA     Tm(°C): 59.964     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CAAACCAGGGGTCATGGAGG     Tm(°C): 60.324     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 1516     End: 1833     Product size (bp): 318
JBrowse View      JBrowse

Enzyme Id:  K17108
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103318985     NCBI Gene Symbol: LOC103318985
Gene Aliases
Gene description & Other designations Description:   non-lysosomal glucosylceramidase      Other designations:   non-lysosomal glucosylceramidase
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   minus     Exon count:   20
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 781060 ...... 790460
CDS Sequence 103318985
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (ATGGA)2tcttactttaattatgacaacagtggtcag(AGTTCA)2
Repeat start & end within CDS Repeat start: 2208     Repeat end: 2259
Forward primer Primer sequence:   AAGTAGGCGACAAGGGTTCG     Tm(°C): 60.038     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TCCGGCCAATTGATCAGCTT     Tm(°C): 60.034     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 2134     End: 2285     Product size (bp): 152
JBrowse View      JBrowse

Enzyme Id:  K17108
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103318985     NCBI Gene Symbol: LOC103318985
Gene Aliases
Gene description & Other designations Description:   non-lysosomal glucosylceramidase      Other designations:   non-lysosomal glucosylceramidase
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   minus     Exon count:   20
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 781060 ...... 790460
CDS Sequence 103318985
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   CTTAATTCCGGGGGCACAGT     Tm(°C): 60.034     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TATGGGCGTGTGAACTTGCT     Tm(°C): 59.964     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 1335     End: 1532     Product size (bp): 198
JBrowse View      JBrowse

Enzyme Id:  K17108
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103324329     NCBI Gene Symbol: LOC103324329
Gene Aliases
Gene description & Other designations Description:   non-lysosomal glucosylceramidase      Other designations:   non-lysosomal glucosylceramidase
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   plus     Exon count:   18
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 41976681 ...... 41987720
CDS Sequence 103324329
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (TTTGAT)2agtgcggccccaccagaacatgcat(GGA)3
Repeat start & end within CDS Repeat start: 82     Repeat end: 127
Forward primer Primer sequence:   AAGAATTCATGGCCGCCTGA     Tm(°C): 60.034     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CATCCCTCCAAGTGGAACCC     Tm(°C): 60.034     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 30     End: 323     Product size (bp): 294
JBrowse View      JBrowse

Enzyme Id:  K17108
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103324329     NCBI Gene Symbol: LOC103324329
Gene Aliases
Gene description & Other designations Description:   non-lysosomal glucosylceramidase      Other designations:   non-lysosomal glucosylceramidase
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   plus     Exon count:   18
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 41976681 ...... 41987720
CDS Sequence 103324329
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (GGTTA)2
Repeat start & end within CDS Repeat start: 192     Repeat end: 201
Forward primer Primer sequence:   ATTTTGATAGTGCGGCCCCA     Tm(°C): 60.034     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CATCCCTCCAAGTGGAACCC     Tm(°C): 60.034     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 85     End: 323     Product size (bp): 239
JBrowse View      JBrowse

Enzyme Id:  K17108
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103324329     NCBI Gene Symbol: LOC103324329
Gene Aliases
Gene description & Other designations Description:   non-lysosomal glucosylceramidase      Other designations:   non-lysosomal glucosylceramidase
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   plus     Exon count:   18
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 41976681 ...... 41987720
CDS Sequence 103324329
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (CTGAAG)2
Repeat start & end within CDS Repeat start: 1463     Repeat end: 1474
Forward primer Primer sequence:   AGCTCAGGACTTGGTGCATC     Tm(°C): 60.036     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ATGCTCGACAACTGTGCCTT     Tm(°C): 60.25     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 1217     End: 1505     Product size (bp): 289
JBrowse View      JBrowse

Enzyme Id:  K17108
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103324329     NCBI Gene Symbol: LOC103324329
Gene Aliases
Gene description & Other designations Description:   non-lysosomal glucosylceramidase      Other designations:   non-lysosomal glucosylceramidase
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   plus     Exon count:   18
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 41976681 ...... 41987720
CDS Sequence 103324329
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (AAAGT)2
Repeat start & end within CDS Repeat start: 1723     Repeat end: 1732
Forward primer Primer sequence:   AAGGCACAGTTGTCGAGCAT     Tm(°C): 60.25     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CCACGGATCATGTGTTCCCA     Tm(°C): 60.036     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1486     End: 1808     Product size (bp): 323
JBrowse View      JBrowse

Enzyme Id:  K17108
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103324329     NCBI Gene Symbol: LOC103324329
Gene Aliases
Gene description & Other designations Description:   non-lysosomal glucosylceramidase      Other designations:   non-lysosomal glucosylceramidase
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   plus     Exon count:   18
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 41976681 ...... 41987720
CDS Sequence 103324329
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (AGCTGC)2
Repeat start & end within CDS Repeat start: 2091     Repeat end: 2102
Forward primer Primer sequence:   TGGGAACACATGATCCGTGG     Tm(°C): 60.036     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TCAGCAAAAGCTTTGTCGCC     Tm(°C): 59.969     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 1789     End: 2137     Product size (bp): 349
JBrowse View      JBrowse

Enzyme Id:  K17108
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103324329     NCBI Gene Symbol: LOC103324329
Gene Aliases
Gene description & Other designations Description:   non-lysosomal glucosylceramidase      Other designations:   non-lysosomal glucosylceramidase
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   plus     Exon count:   18
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 41976681 ...... 41987720
CDS Sequence 103324329
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Di     Repeat sequence: (AT)4
Repeat start & end within CDS Repeat start: 2620     Repeat end: 2627
Forward primer Primer sequence:   CCAGACTCCTGAGGGATGGA     Tm(°C): 60.032     GC (%): 60     Size: 20
Reverse primer Primer sequence:   AAGCACTTTGCCTTGGTTGC     Tm(°C): 60.179     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 2573     End: 2794     Product size (bp): 222
JBrowse View      JBrowse

Enzyme Id:  K17108
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103324329     NCBI Gene Symbol: LOC103324329
Gene Aliases
Gene description & Other designations Description:   non-lysosomal glucosylceramidase      Other designations:   non-lysosomal glucosylceramidase
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   plus     Exon count:   18
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 41976681 ...... 41987720
CDS Sequence 103324329
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   GTGAGTGTGACCGTTTTGCC     Tm(°C): 59.971     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ATGAAGACATGCATGGCCCA     Tm(°C): 60.033     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 912     End: 1047     Product size (bp): 136
JBrowse View      JBrowse