Statistics
Number of enzymes: 1
Total Number of designed primers: 2
Number of PGTM primers: 1
Number of PMTM primers: 1
|
| Gene Information | |
NCBI Gene Accession Number & Symbol | Accession Number: 103329780 NCBI Gene Symbol: LOC103329780 |
Gene Aliases | |
Gene description & Other designations | Description: glucuronokinase 1 Other designations: glucuronokinase 1 |
Chromosome, Strand & Exon count | Chromosome: LG4 Strand: minus Exon count: 6 |
Gene Location within genomic sequence | Genomic accession No. NC_024129.1 Gene Start and end within genomic accession: 20548119 ...... 20550352 |
CDS Sequence | 103329780 |
| Marker Information | |
Marker Type | PMTM |
Repeat type & sequence | Repeat type: Penta Repeat sequence: (ACCCC)2 |
Repeat start & end within CDS | Repeat start: 177 Repeat end: 186 |
Forward primer | Primer sequence: CTTCTGGGCCACCGTGTATT Tm(°C): 60.035 GC (%): 55 Size: 20 |
Reverse primer | Primer sequence: GCGGACCTCGACTTTGATCA Tm(°C): 60.109 GC (%): 55 Size: 20 |
Primer start, end within sequence and product size | Start: 128 End: 470 Product size (bp): 343 |
JBrowse View | JBrowse |
|
| Gene Information | |
NCBI Gene Accession Number & Symbol | Accession Number: 103329780 NCBI Gene Symbol: LOC103329780 |
Gene Aliases | |
Gene description & Other designations | Description: glucuronokinase 1 Other designations: glucuronokinase 1 |
Chromosome, Strand & Exon count | Chromosome: LG4 Strand: minus Exon count: 6 |
Gene Location within genomic sequence | Genomic accession No. NC_024129.1 Gene Start and end within genomic accession: 20548119 ...... 20550352 |
CDS Sequence | 103329780 |
| Marker Information | |
Marker Type | PGTM |
Repeat type & sequence | Repeat type: Repeat sequence: |
Repeat start & end within CDS | Repeat start: Repeat end: |
Forward primer | Primer sequence: GTATTTCGGCCGGACGATCT Tm(°C): 59.968 GC (%): 55 Size: 20 |
Reverse primer | Primer sequence: TACACCTGGGCAACACGATC Tm(°C): 60.037 GC (%): 55 Size: 20 |
Primer start, end within sequence and product size | Start: 92 End: 544 Product size (bp): 453 |
JBrowse View | JBrowse |