image


Statistics

Number of enzymes: 1
Total Number of designed primers: 16
Number of PGTM primers:     4
Number of PMTM primers:     12
Number of Failed designed PMTM primers: 1

Enzyme Id:  K15889
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111472826     NCBI Gene Symbol: LOC111472826
Gene Aliases
Gene description & Other designations Description:   probable isoprenylcysteine alpha-carbonyl methylesterase ICMEL1      Other designations:   probable isoprenylcysteine alpha-carbonyl methylesterase ICMEL1
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111472826
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (GGGTA)2
Repeat start & end within CDS Repeat start: 239     Repeat end: 248
Forward primer Primer sequence:   TTCCTTTCTTTTCCGGCGGA     Tm(°C): 59.891     GC (%): 50     Size: 20
Reverse primer Primer sequence:   TGGCTTTGGGTCTGGGTTTT     Tm(°C): 60.032     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 92     End: 440     Product size (bp): 349
JBrowse View      JBrowse

Enzyme Id:  K15889
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111472826     NCBI Gene Symbol: LOC111472826
Gene Aliases
Gene description & Other designations Description:   probable isoprenylcysteine alpha-carbonyl methylesterase ICMEL1      Other designations:   probable isoprenylcysteine alpha-carbonyl methylesterase ICMEL1
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111472826
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (TAT)3
Repeat start & end within CDS Repeat start: 322     Repeat end: 330
Forward primer Primer sequence:   TTCCTTTCTTTTCCGGCGGA     Tm(°C): 59.891     GC (%): 50     Size: 20
Reverse primer Primer sequence:   TGGCTTTGGGTCTGGGTTTT     Tm(°C): 60.032     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 92     End: 440     Product size (bp): 349
JBrowse View      JBrowse

Enzyme Id:  K15889
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111472826     NCBI Gene Symbol: LOC111472826
Gene Aliases
Gene description & Other designations Description:   probable isoprenylcysteine alpha-carbonyl methylesterase ICMEL1      Other designations:   probable isoprenylcysteine alpha-carbonyl methylesterase ICMEL1
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111472826
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GGT)3
Repeat start & end within CDS Repeat start: 730     Repeat end: 738
Forward primer Primer sequence:   AAAACCCAGACCCAAAGCCA     Tm(°C): 60.032     GC (%): 50     Size: 20
Reverse primer Primer sequence:   GGACACACTCCAAGACACCC     Tm(°C): 60.25     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 421     End: 761     Product size (bp): 341
JBrowse View      JBrowse

Enzyme Id:  K15889
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111472826     NCBI Gene Symbol: LOC111472826
Gene Aliases
Gene description & Other designations Description:   probable isoprenylcysteine alpha-carbonyl methylesterase ICMEL1      Other designations:   probable isoprenylcysteine alpha-carbonyl methylesterase ICMEL1
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111472826
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (GATTT)2
Repeat start & end within CDS Repeat start: 1132     Repeat end: 1141
Forward primer Primer sequence:   GCCAGTAAGAGCTTCGCAGA     Tm(°C): 60.109     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GGGCTAACACGCTGAGCTAA     Tm(°C): 60.108     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 999     End: 1249     Product size (bp): 251
JBrowse View      JBrowse

Enzyme Id:  K15889
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111472826     NCBI Gene Symbol: LOC111472826
Gene Aliases
Gene description & Other designations Description:   probable isoprenylcysteine alpha-carbonyl methylesterase ICMEL1      Other designations:   probable isoprenylcysteine alpha-carbonyl methylesterase ICMEL1
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111472826
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (TCT)6
Repeat start & end within CDS Repeat start: 7     Repeat end: 24
Forward primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Reverse primer Primer sequence:   None     Tm(°C):      GC (%):      Size:
Primer start, end within sequence and product size Start:      End:      Product size (bp):
JBrowse View      JBrowse

Enzyme Id:  K15889
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111472826     NCBI Gene Symbol: LOC111472826
Gene Aliases
Gene description & Other designations Description:   probable isoprenylcysteine alpha-carbonyl methylesterase ICMEL1      Other designations:   probable isoprenylcysteine alpha-carbonyl methylesterase ICMEL1
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111472826
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   TCCAACCAGGTTCGACGAAG     Tm(°C): 59.967     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TGGCTTTGGGTCTGGGTTTT     Tm(°C): 60.032     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 336     End: 440     Product size (bp): 105
JBrowse View      JBrowse

Enzyme Id:  K15889
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111477934     NCBI Gene Symbol: LOC111477934
Gene Aliases
Gene description & Other designations Description:   isoprenylcysteine alpha-carbonyl methylesterase ICME      Other designations:   isoprenylcysteine alpha-carbonyl methylesterase ICME
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111477934
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (CAATT)2
Repeat start & end within CDS Repeat start: 75     Repeat end: 84
Forward primer Primer sequence:   ACCTATAACCCAGCCCCCTT     Tm(°C): 59.953     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TTTTCGCTCTTGACTCGCCT     Tm(°C): 59.966     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 20     End: 298     Product size (bp): 279
JBrowse View      JBrowse

Enzyme Id:  K15889
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111477934     NCBI Gene Symbol: LOC111477934
Gene Aliases
Gene description & Other designations Description:   isoprenylcysteine alpha-carbonyl methylesterase ICME      Other designations:   isoprenylcysteine alpha-carbonyl methylesterase ICME
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111477934
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (TTC)3
Repeat start & end within CDS Repeat start: 482     Repeat end: 490
Forward primer Primer sequence:   AGGCGAGTCAAGAGCGAAAA     Tm(°C): 59.966     GC (%): 50     Size: 20
Reverse primer Primer sequence:   TGCAACAACTGGTTTTGGCC     Tm(°C): 60.108     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 279     End: 626     Product size (bp): 348
JBrowse View      JBrowse

Enzyme Id:  K15889
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111477934     NCBI Gene Symbol: LOC111477934
Gene Aliases
Gene description & Other designations Description:   isoprenylcysteine alpha-carbonyl methylesterase ICME      Other designations:   isoprenylcysteine alpha-carbonyl methylesterase ICME
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111477934
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (TATTC)2
Repeat start & end within CDS Repeat start: 1165     Repeat end: 1174
Forward primer Primer sequence:   AACATGGGAGCTGCAGTCTC     Tm(°C): 60.036     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ATCTTTGCCTCCCCTCAACG     Tm(°C): 60.035     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1104     End: 1301     Product size (bp): 198
JBrowse View      JBrowse

Enzyme Id:  K15889
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111477934     NCBI Gene Symbol: LOC111477934
Gene Aliases
Gene description & Other designations Description:   isoprenylcysteine alpha-carbonyl methylesterase ICME      Other designations:   isoprenylcysteine alpha-carbonyl methylesterase ICME
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111477934
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (ATGTTG)2
Repeat start & end within CDS Repeat start: 1405     Repeat end: 1416
Forward primer Primer sequence:   CGTTGAGGGGAGGCAAAGAT     Tm(°C): 60.035     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ACCTACAATGGATGGAACTACG     Tm(°C): 57.598     GC (%): 45.455     Size: 22
Primer start, end within sequence and product size Start: 1282     End: 1440     Product size (bp): 159
JBrowse View      JBrowse

Enzyme Id:  K15889
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111477934     NCBI Gene Symbol: LOC111477934
Gene Aliases
Gene description & Other designations Description:   isoprenylcysteine alpha-carbonyl methylesterase ICME      Other designations:   isoprenylcysteine alpha-carbonyl methylesterase ICME
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111477934
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   CGTTGAGGGGAGGCAAAGAT     Tm(°C): 60.035     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AAGGCGTCTTCTTGGAGGTG     Tm(°C): 59.965     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1282     End: 1391     Product size (bp): 110
JBrowse View      JBrowse

Enzyme Id:  K15889
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111482152     NCBI Gene Symbol: LOC111482152
Gene Aliases
Gene description & Other designations Description:   isoprenylcysteine alpha-carbonyl methylesterase ICME-like      Other designations:   isoprenylcysteine alpha-carbonyl methylesterase ICME-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111482152
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (TGC)3ggtaacg(CTT)3actcggttgggcttcactctccttcgatctcttg(G
GGTA)2
Repeat start & end within CDS Repeat start: 168     Repeat end: 236
Forward primer Primer sequence:   GGCCAAGGGATTCGTTCTGA     Tm(°C): 60.035     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TCCCTCCGAACCTGACTTGA     Tm(°C): 60.179     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 45     End: 343     Product size (bp): 299
JBrowse View      JBrowse

Enzyme Id:  K15889
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111482152     NCBI Gene Symbol: LOC111482152
Gene Aliases
Gene description & Other designations Description:   isoprenylcysteine alpha-carbonyl methylesterase ICME-like      Other designations:   isoprenylcysteine alpha-carbonyl methylesterase ICME-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111482152
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Di     Repeat sequence: (AG)4
Repeat start & end within CDS Repeat start: 495     Repeat end: 502
Forward primer Primer sequence:   AAAGCCTGGGGAGCACTTTT     Tm(°C): 60.106     GC (%): 50     Size: 20
Reverse primer Primer sequence:   GCTCCAAGAAGGCACAAACG     Tm(°C): 60.04     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 459     End: 690     Product size (bp): 232
JBrowse View      JBrowse

Enzyme Id:  K15889
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111482152     NCBI Gene Symbol: LOC111482152
Gene Aliases
Gene description & Other designations Description:   isoprenylcysteine alpha-carbonyl methylesterase ICME-like      Other designations:   isoprenylcysteine alpha-carbonyl methylesterase ICME-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111482152
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   GGCCAAGGGATTCGTTCTGA     Tm(°C): 60.035     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CGGTACCCTACCCCAAGAGA     Tm(°C): 60.033     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 45     End: 238     Product size (bp): 194
JBrowse View      JBrowse

Enzyme Id:  K15889
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111493009     NCBI Gene Symbol: LOC111493009
Gene Aliases
Gene description & Other designations Description:   isoprenylcysteine alpha-carbonyl methylesterase ICME-like      Other designations:   isoprenylcysteine alpha-carbonyl methylesterase ICME-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111493009
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (TGC)3ggagaccgttcttgttactcggttgagcttcactctccttcgatctctt
g(GGGTA)2
Repeat start & end within CDS Repeat start: 213     Repeat end: 281
Forward primer Primer sequence:   TTGATCAGGATTCGGCGGAG     Tm(°C): 59.895     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCGGGCATAAGAAGAATGGC     Tm(°C): 59.046     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 61     End: 337     Product size (bp): 277
JBrowse View      JBrowse

Enzyme Id:  K15889
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111493009     NCBI Gene Symbol: LOC111493009
Gene Aliases
Gene description & Other designations Description:   isoprenylcysteine alpha-carbonyl methylesterase ICME-like      Other designations:   isoprenylcysteine alpha-carbonyl methylesterase ICME-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111493009
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Di     Repeat sequence: (AG)4
Repeat start & end within CDS Repeat start: 540     Repeat end: 547
Forward primer Primer sequence:   GGGAATAAAGCATGGGGAGCT     Tm(°C): 60.133     GC (%): 52.381     Size: 21
Reverse primer Primer sequence:   ACGCTCTCTCCTTTTCCAGC     Tm(°C): 60.037     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 498     End: 769     Product size (bp): 272
JBrowse View      JBrowse

Enzyme Id:  K15889
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111493009     NCBI Gene Symbol: LOC111493009
Gene Aliases
Gene description & Other designations Description:   isoprenylcysteine alpha-carbonyl methylesterase ICME-like      Other designations:   isoprenylcysteine alpha-carbonyl methylesterase ICME-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111493009
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   GAGCACTTCGATAGTCGGGG     Tm(°C): 59.969     GC (%): 60     Size: 20
Reverse primer Primer sequence:   TGCCTCCACGAAAAGGATCC     Tm(°C): 60.035     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 840     End: 1137     Product size (bp): 298
JBrowse View      JBrowse