PlantPathMarks Database

Statistics

Number of enzymes: 1

Total Number of designed primers: 21

Number of PGTM primers: 6

Number of PMTM primers: 15

Number of Failed designed PMTM primers: 1

Enzyme Id: K15400
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 103338107 NCBI Gene Symbol: LOC103338107
Gene Aliases
Gene description & Other designations	Description: omega-hydroxypalmitate O-feruloyl transferase Other designations: omega-hydroxypalmitate O-feruloyl transferase
Chromosome, Strand & Exon count	Chromosome: LG7 Strand: plus Exon count: 3
Gene Location within genomic sequence	Genomic accession No. NC_024132.1 Gene Start and end within genomic accession: 12941605 ...... 12943760
CDS Sequence	103338107
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Hexa Repeat sequence: (TGAAGC)2
Repeat start & end within CDS	Repeat start: 309 Repeat end: 320
Forward primer	Primer sequence: AGGAGATGGTGCCGTGTTTG Tm(°C): 60.606 GC (%): 55 Size: 20
Reverse primer	Primer sequence: GGACCTTAAGTGGCAAGCCT Tm(°C): 59.962 GC (%): 55 Size: 20
Primer start, end within sequence and product size	Start: 287 End: 570 Product size (bp): 284
JBrowse View	JBrowse

Enzyme Id: K15400
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 103338107 NCBI Gene Symbol: LOC103338107
Gene Aliases
Gene description & Other designations	Description: omega-hydroxypalmitate O-feruloyl transferase Other designations: omega-hydroxypalmitate O-feruloyl transferase
Chromosome, Strand & Exon count	Chromosome: LG7 Strand: plus Exon count: 3
Gene Location within genomic sequence	Genomic accession No. NC_024132.1 Gene Start and end within genomic accession: 12941605 ...... 12943760
CDS Sequence	103338107
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Compound Repeat sequence: (GAA)3ttgctatatagg(TCTT)3
Repeat start & end within CDS	Repeat start: 682 Repeat end: 714
Forward primer	Primer sequence: CTGCTAGAGGCTTGCCACTT Tm(°C): 60.036 GC (%): 55 Size: 20
Reverse primer	Primer sequence: ATCTTGAGCGCCCATCAACA Tm(°C): 60.035 GC (%): 50 Size: 20
Primer start, end within sequence and product size	Start: 544 End: 888 Product size (bp): 345
JBrowse View	JBrowse

Enzyme Id: K15400
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 103338107 NCBI Gene Symbol: LOC103338107
Gene Aliases
Gene description & Other designations	Description: omega-hydroxypalmitate O-feruloyl transferase Other designations: omega-hydroxypalmitate O-feruloyl transferase
Chromosome, Strand & Exon count	Chromosome: LG7 Strand: plus Exon count: 3
Gene Location within genomic sequence	Genomic accession No. NC_024132.1 Gene Start and end within genomic accession: 12941605 ...... 12943760
CDS Sequence	103338107
	Marker Information
Marker Type	PGTM
Repeat type & sequence	Repeat type: Repeat sequence:
Repeat start & end within CDS	Repeat start: Repeat end:
Forward primer	Primer sequence: CTGCTAGAGGCTTGCCACTT Tm(°C): 60.036 GC (%): 55 Size: 20
Reverse primer	Primer sequence: ATCTTGAGCGCCCATCAACA Tm(°C): 60.035 GC (%): 50 Size: 20
Primer start, end within sequence and product size	Start: 544 End: 888 Product size (bp): 345
JBrowse View	JBrowse

Enzyme Id: K15400
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 103340985 NCBI Gene Symbol: LOC103340985
Gene Aliases
Gene description & Other designations	Description: omega-hydroxypalmitate O-feruloyl transferase Other designations: omega-hydroxypalmitate O-feruloyl transferase
Chromosome, Strand & Exon count	Chromosome: LG8 Strand: plus Exon count: 2
Gene Location within genomic sequence	Genomic accession No. NC_024133.1 Gene Start and end within genomic accession: 15293304 ...... 15295202
CDS Sequence	103340985
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Di Repeat sequence: (GA)4
Repeat start & end within CDS	Repeat start: 273 Repeat end: 280
Forward primer	Primer sequence: GTTGGAGCCCGTGTTTTCAC Tm(°C): 59.97 GC (%): 55 Size: 20
Reverse primer	Primer sequence: GGTCTTGCCCGAAAAACACC Tm(°C): 59.968 GC (%): 55 Size: 20
Primer start, end within sequence and product size	Start: 144 End: 318 Product size (bp): 175
JBrowse View	JBrowse

Enzyme Id: K15400
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 103340985 NCBI Gene Symbol: LOC103340985
Gene Aliases
Gene description & Other designations	Description: omega-hydroxypalmitate O-feruloyl transferase Other designations: omega-hydroxypalmitate O-feruloyl transferase
Chromosome, Strand & Exon count	Chromosome: LG8 Strand: plus Exon count: 2
Gene Location within genomic sequence	Genomic accession No. NC_024133.1 Gene Start and end within genomic accession: 15293304 ...... 15295202
CDS Sequence	103340985
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Penta Repeat sequence: (GCTTG)2
Repeat start & end within CDS	Repeat start: 983 Repeat end: 992
Forward primer	Primer sequence: GGCCTGGCTGAAAACTTTGG Tm(°C): 59.966 GC (%): 55 Size: 20
Reverse primer	Primer sequence: ACTCTTCCGAGATGCCAAGC Tm(°C): 60.108 GC (%): 55 Size: 20
Primer start, end within sequence and product size	Start: 767 End: 1083 Product size (bp): 317
JBrowse View	JBrowse

Enzyme Id: K15400
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 103340985 NCBI Gene Symbol: LOC103340985
Gene Aliases
Gene description & Other designations	Description: omega-hydroxypalmitate O-feruloyl transferase Other designations: omega-hydroxypalmitate O-feruloyl transferase
Chromosome, Strand & Exon count	Chromosome: LG8 Strand: plus Exon count: 2
Gene Location within genomic sequence	Genomic accession No. NC_024133.1 Gene Start and end within genomic accession: 15293304 ...... 15295202
CDS Sequence	103340985
	Marker Information
Marker Type	PGTM
Repeat type & sequence	Repeat type: Repeat sequence:
Repeat start & end within CDS	Repeat start: Repeat end:
Forward primer	Primer sequence: GTTGGAGCCCGTGTTTTCAC Tm(°C): 59.97 GC (%): 55 Size: 20
Reverse primer	Primer sequence: GGTCTTGCCCGAAAAACACC Tm(°C): 59.968 GC (%): 55 Size: 20
Primer start, end within sequence and product size	Start: 144 End: 318 Product size (bp): 175
JBrowse View	JBrowse

Enzyme Id: K15400
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 103334533 NCBI Gene Symbol: LOC103334533
Gene Aliases
Gene description & Other designations	Description: omega-hydroxypalmitate O-feruloyl transferase-like Other designations: omega-hydroxypalmitate O-feruloyl transferase-like
Chromosome, Strand & Exon count	Chromosome: LG6 Strand: plus Exon count: 1
Gene Location within genomic sequence	Genomic accession No. NC_024131.1 Gene Start and end within genomic accession: 2422219 ...... 2423652
CDS Sequence	103334533
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Tri Repeat sequence: (TGT)3
Repeat start & end within CDS	Repeat start: 282 Repeat end: 290
Forward primer	Primer sequence: CACACTCGGTCCCTTGCTAG Tm(°C): 60.109 GC (%): 60 Size: 20
Reverse primer	Primer sequence: TGAAACGACACAAGGGGCTT Tm(°C): 60.107 GC (%): 50 Size: 20
Primer start, end within sequence and product size	Start: 179 End: 430 Product size (bp): 252
JBrowse View	JBrowse

Enzyme Id: K15400
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 103334533 NCBI Gene Symbol: LOC103334533
Gene Aliases
Gene description & Other designations	Description: omega-hydroxypalmitate O-feruloyl transferase-like Other designations: omega-hydroxypalmitate O-feruloyl transferase-like
Chromosome, Strand & Exon count	Chromosome: LG6 Strand: plus Exon count: 1
Gene Location within genomic sequence	Genomic accession No. NC_024131.1 Gene Start and end within genomic accession: 2422219 ...... 2423652
CDS Sequence	103334533
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Tri Repeat sequence: (TGC)3
Repeat start & end within CDS	Repeat start: 1334 Repeat end: 1342
Forward primer	Primer sequence: GGTTCCTGCCTTTGCACATG Tm(°C): 60.038 GC (%): 55 Size: 20
Reverse primer	Primer sequence: AATGCTGAGGCCTCCCTTTC Tm(°C): 60.034 GC (%): 55 Size: 20
Primer start, end within sequence and product size	Start: 1064 End: 1373 Product size (bp): 310
JBrowse View	JBrowse

Enzyme Id: K15400
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 103334533 NCBI Gene Symbol: LOC103334533
Gene Aliases
Gene description & Other designations	Description: omega-hydroxypalmitate O-feruloyl transferase-like Other designations: omega-hydroxypalmitate O-feruloyl transferase-like
Chromosome, Strand & Exon count	Chromosome: LG6 Strand: plus Exon count: 1
Gene Location within genomic sequence	Genomic accession No. NC_024131.1 Gene Start and end within genomic accession: 2422219 ...... 2423652
CDS Sequence	103334533
	Marker Information
Marker Type	PGTM
Repeat type & sequence	Repeat type: Repeat sequence:
Repeat start & end within CDS	Repeat start: Repeat end:
Forward primer	Primer sequence: GGTTCCTGCCTTTGCACATG Tm(°C): 60.038 GC (%): 55 Size: 20
Reverse primer	Primer sequence: AATGCTGAGGCCTCCCTTTC Tm(°C): 60.034 GC (%): 55 Size: 20
Primer start, end within sequence and product size	Start: 1064 End: 1373 Product size (bp): 310
JBrowse View	JBrowse

Enzyme Id: K15400
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 103334534 NCBI Gene Symbol: LOC103334534
Gene Aliases
Gene description & Other designations	Description: omega-hydroxypalmitate O-feruloyl transferase-like Other designations: omega-hydroxypalmitate O-feruloyl transferase-like
Chromosome, Strand & Exon count	Chromosome: LG6 Strand: plus Exon count: 3
Gene Location within genomic sequence	Genomic accession No. NC_024131.1 Gene Start and end within genomic accession: 2424939 ...... 2426273
CDS Sequence	103334534
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Tri Repeat sequence: (TGT)3
Repeat start & end within CDS	Repeat start: 138 Repeat end: 146
Forward primer	Primer sequence: TTCACACACTCGGTCCCTTG Tm(°C): 59.894 GC (%): 55 Size: 20
Reverse primer	Primer sequence: TGAAACGACACAAGGGGCTT Tm(°C): 60.107 GC (%): 50 Size: 20
Primer start, end within sequence and product size	Start: 31 End: 286 Product size (bp): 256
JBrowse View	JBrowse

Enzyme Id: K15400
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 103334534 NCBI Gene Symbol: LOC103334534
Gene Aliases
Gene description & Other designations	Description: omega-hydroxypalmitate O-feruloyl transferase-like Other designations: omega-hydroxypalmitate O-feruloyl transferase-like
Chromosome, Strand & Exon count	Chromosome: LG6 Strand: plus Exon count: 3
Gene Location within genomic sequence	Genomic accession No. NC_024131.1 Gene Start and end within genomic accession: 2424939 ...... 2426273
CDS Sequence	103334534
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Tri Repeat sequence: (TGC)3
Repeat start & end within CDS	Repeat start: 986 Repeat end: 994
Forward primer	Primer sequence: GGTTCCTGCCTTTGCACATG Tm(°C): 60.038 GC (%): 55 Size: 20
Reverse primer	Primer sequence: TTCCAGGCATATGCTGAGGC Tm(°C): 60.179 GC (%): 55 Size: 20
Primer start, end within sequence and product size	Start: 716 End: 1034 Product size (bp): 319
JBrowse View	JBrowse

Enzyme Id: K15400
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 103336463 NCBI Gene Symbol: LOC103336463
Gene Aliases
Gene description & Other designations	Description: omega-hydroxypalmitate O-feruloyl transferase-like Other designations: omega-hydroxypalmitate O-feruloyl transferase-like
Chromosome, Strand & Exon count	Chromosome: LG6 Strand: minus Exon count: 2
Gene Location within genomic sequence	Genomic accession No. NC_024131.1 Gene Start and end within genomic accession: 20196187 ...... 20197821
CDS Sequence	103336463
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Tri Repeat sequence: (TGT)3
Repeat start & end within CDS	Repeat start: 282 Repeat end: 290
Forward primer	Primer sequence: TTCACACACTCGGTCCCTTG Tm(°C): 59.894 GC (%): 55 Size: 20
Reverse primer	Primer sequence: TGAAACGACACAAGGGGCTT Tm(°C): 60.107 GC (%): 50 Size: 20
Primer start, end within sequence and product size	Start: 175 End: 430 Product size (bp): 256
JBrowse View	JBrowse

Enzyme Id: K15400
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 103336463 NCBI Gene Symbol: LOC103336463
Gene Aliases
Gene description & Other designations	Description: omega-hydroxypalmitate O-feruloyl transferase-like Other designations: omega-hydroxypalmitate O-feruloyl transferase-like
Chromosome, Strand & Exon count	Chromosome: LG6 Strand: minus Exon count: 2
Gene Location within genomic sequence	Genomic accession No. NC_024131.1 Gene Start and end within genomic accession: 20196187 ...... 20197821
CDS Sequence	103336463
	Marker Information
Marker Type	PGTM
Repeat type & sequence	Repeat type: Repeat sequence:
Repeat start & end within CDS	Repeat start: Repeat end:
Forward primer	Primer sequence: CAGCCCCGGAGACTTTTCTT Tm(°C): 59.963 GC (%): 55 Size: 20
Reverse primer	Primer sequence: TCTGTCCTAGCTGCAGCAAC Tm(°C): 60.037 GC (%): 55 Size: 20
Primer start, end within sequence and product size	Start: 54 End: 307 Product size (bp): 254
JBrowse View	JBrowse

Enzyme Id: K15400
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 103336520 NCBI Gene Symbol: LOC103336520
Gene Aliases
Gene description & Other designations	Description: shikimate O-hydroxycinnamoyltransferase-like Other designations: shikimate O-hydroxycinnamoyltransferase-like
Chromosome, Strand & Exon count	Chromosome: LG6 Strand: minus Exon count: 3
Gene Location within genomic sequence	Genomic accession No. NC_024131.1 Gene Start and end within genomic accession: 20662778 ...... 20664208
CDS Sequence	103336520
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Tri Repeat sequence: (TGT)3
Repeat start & end within CDS	Repeat start: 282 Repeat end: 290
Forward primer	Primer sequence: TTCACACACTCGGTCCCTTG Tm(°C): 59.894 GC (%): 55 Size: 20
Reverse primer	Primer sequence: TGAAACGACACAAGGGGCTT Tm(°C): 60.107 GC (%): 50 Size: 20
Primer start, end within sequence and product size	Start: 175 End: 430 Product size (bp): 256
JBrowse View	JBrowse

Enzyme Id: K15400
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 103336520 NCBI Gene Symbol: LOC103336520
Gene Aliases
Gene description & Other designations	Description: shikimate O-hydroxycinnamoyltransferase-like Other designations: shikimate O-hydroxycinnamoyltransferase-like
Chromosome, Strand & Exon count	Chromosome: LG6 Strand: minus Exon count: 3
Gene Location within genomic sequence	Genomic accession No. NC_024131.1 Gene Start and end within genomic accession: 20662778 ...... 20664208
CDS Sequence	103336520
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Tri Repeat sequence: (TGC)3
Repeat start & end within CDS	Repeat start: 875 Repeat end: 883
Forward primer	Primer sequence: GGTTCCTGCCTTTGCACATG Tm(°C): 60.038 GC (%): 55 Size: 20
Reverse primer	Primer sequence: TTCCAGGCATATGCTGAGGC Tm(°C): 60.179 GC (%): 55 Size: 20
Primer start, end within sequence and product size	Start: 605 End: 923 Product size (bp): 319
JBrowse View	JBrowse

Enzyme Id: K15400
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 103320755 NCBI Gene Symbol: LOC103320755
Gene Aliases
Gene description & Other designations	Description: omega-hydroxypalmitate O-feruloyl transferase Other designations: omega-hydroxypalmitate O-feruloyl transferase
Chromosome, Strand & Exon count	Chromosome: LG2 Strand: plus Exon count: 3
Gene Location within genomic sequence	Genomic accession No. NC_024127.1 Gene Start and end within genomic accession: 12525486 ...... 12529171
CDS Sequence	103320755
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Compound Repeat sequence: (GTCCA)2tatgtacttggttttcttttacgaacacgag(AAT)3
Repeat start & end within CDS	Repeat start: 125 Repeat end: 174
Forward primer	Primer sequence: CCAAAACCGCGTCTGTGTTT Tm(°C): 59.9 GC (%): 50 Size: 20
Reverse primer	Primer sequence: GATCTCGACCTGCGTCTCTG Tm(°C): 59.971 GC (%): 60 Size: 20
Primer start, end within sequence and product size	Start: 49 End: 353 Product size (bp): 305
JBrowse View	JBrowse

Enzyme Id: K15400
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 103320755 NCBI Gene Symbol: LOC103320755
Gene Aliases
Gene description & Other designations	Description: omega-hydroxypalmitate O-feruloyl transferase Other designations: omega-hydroxypalmitate O-feruloyl transferase
Chromosome, Strand & Exon count	Chromosome: LG2 Strand: plus Exon count: 3
Gene Location within genomic sequence	Genomic accession No. NC_024127.1 Gene Start and end within genomic accession: 12525486 ...... 12529171
CDS Sequence	103320755
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Compound Repeat sequence: (CGG)3ggaggttgaccttgaaccctagtgatggaaataagcttaacttgtggtg (CAA)3
Repeat start & end within CDS	Repeat start: 248 Repeat end: 314
Forward primer	Primer sequence: CCAAAACCGCGTCTGTGTTT Tm(°C): 59.9 GC (%): 50 Size: 20
Reverse primer	Primer sequence: GATCTCGACCTGCGTCTCTG Tm(°C): 59.971 GC (%): 60 Size: 20
Primer start, end within sequence and product size	Start: 49 End: 353 Product size (bp): 305
JBrowse View	JBrowse

Enzyme Id: K15400
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 103320755 NCBI Gene Symbol: LOC103320755
Gene Aliases
Gene description & Other designations	Description: omega-hydroxypalmitate O-feruloyl transferase Other designations: omega-hydroxypalmitate O-feruloyl transferase
Chromosome, Strand & Exon count	Chromosome: LG2 Strand: plus Exon count: 3
Gene Location within genomic sequence	Genomic accession No. NC_024127.1 Gene Start and end within genomic accession: 12525486 ...... 12529171
CDS Sequence	103320755
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Tri Repeat sequence: (AGC)4
Repeat start & end within CDS	Repeat start: 771 Repeat end: 782
Forward primer	Primer sequence: CTGCTGCCGTGGATCATTTG Tm(°C): 59.9 GC (%): 55 Size: 20
Reverse primer	Primer sequence: CTTCCAGAGGTGAGCAGCAA Tm(°C): 59.964 GC (%): 55 Size: 20
Primer start, end within sequence and product size	Start: 733 End: 947 Product size (bp): 215
JBrowse View	JBrowse

Enzyme Id: K15400
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 103320755 NCBI Gene Symbol: LOC103320755
Gene Aliases
Gene description & Other designations	Description: omega-hydroxypalmitate O-feruloyl transferase Other designations: omega-hydroxypalmitate O-feruloyl transferase
Chromosome, Strand & Exon count	Chromosome: LG2 Strand: plus Exon count: 3
Gene Location within genomic sequence	Genomic accession No. NC_024127.1 Gene Start and end within genomic accession: 12525486 ...... 12529171
CDS Sequence	103320755
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Tri Repeat sequence: (AGC)3
Repeat start & end within CDS	Repeat start: 1290 Repeat end: 1298
Forward primer	Primer sequence: AAGTAGAGCAAGCGACCCAC Tm(°C): 60.037 GC (%): 55 Size: 20
Reverse primer	Primer sequence: GCAACCTGTGGGATTGGAGA Tm(°C): 59.962 GC (%): 55 Size: 20
Primer start, end within sequence and product size	Start: 1096 End: 1336 Product size (bp): 241
JBrowse View	JBrowse

Enzyme Id: K15400
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 103320755 NCBI Gene Symbol: LOC103320755
Gene Aliases
Gene description & Other designations	Description: omega-hydroxypalmitate O-feruloyl transferase Other designations: omega-hydroxypalmitate O-feruloyl transferase
Chromosome, Strand & Exon count	Chromosome: LG2 Strand: plus Exon count: 3
Gene Location within genomic sequence	Genomic accession No. NC_024127.1 Gene Start and end within genomic accession: 12525486 ...... 12529171
CDS Sequence	103320755
	Marker Information
Marker Type	PGTM
Repeat type & sequence	Repeat type: Repeat sequence:
Repeat start & end within CDS	Repeat start: Repeat end:
Forward primer	Primer sequence: GACGCAGGTCGAGATCTCTG Tm(°C): 59.971 GC (%): 60 Size: 20
Reverse primer	Primer sequence: CCTGAGCAACAACCAAAGGC Tm(°C): 59.967 GC (%): 55 Size: 20
Primer start, end within sequence and product size	Start: 338 End: 459 Product size (bp): 122
JBrowse View	JBrowse

Enzyme Id: K15400
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 103330304 NCBI Gene Symbol: LOC103330304
Gene Aliases
Gene description & Other designations	Description: omega-hydroxypalmitate O-feruloyl transferase-like Other designations: omega-hydroxypalmitate O-feruloyl transferase-like
Chromosome, Strand & Exon count	Chromosome: LG4 Strand: minus Exon count: 2
Gene Location within genomic sequence	Genomic accession No. NC_024129.1 Gene Start and end within genomic accession: 23261993 ...... 23263753
CDS Sequence	103330304
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Tri Repeat sequence: (GGC)3
Repeat start & end within CDS	Repeat start: 19 Repeat end: 27
Forward primer	Primer sequence: None Tm(°C): GC (%): Size:
Reverse primer	Primer sequence: None Tm(°C): GC (%): Size:
Primer start, end within sequence and product size	Start: End: Product size (bp):
JBrowse View	JBrowse

Enzyme Id: K15400
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 103330304 NCBI Gene Symbol: LOC103330304
Gene Aliases
Gene description & Other designations	Description: omega-hydroxypalmitate O-feruloyl transferase-like Other designations: omega-hydroxypalmitate O-feruloyl transferase-like
Chromosome, Strand & Exon count	Chromosome: LG4 Strand: minus Exon count: 2
Gene Location within genomic sequence	Genomic accession No. NC_024129.1 Gene Start and end within genomic accession: 23261993 ...... 23263753
CDS Sequence	103330304
	Marker Information
Marker Type	PGTM
Repeat type & sequence	Repeat type: Repeat sequence:
Repeat start & end within CDS	Repeat start: Repeat end:
Forward primer	Primer sequence: CGTAAGTTCAGCCCACCACT Tm(°C): 59.965 GC (%): 55 Size: 20
Reverse primer	Primer sequence: ATGGCAGAAGCTGGAAGACC Tm(°C): 60.035 GC (%): 55 Size: 20
Primer start, end within sequence and product size	Start: 894 End: 1279 Product size (bp): 386
JBrowse View	JBrowse