Statistics
Number of enzymes: 1
Total Number of designed primers: 5
Number of PGTM primers: 1
Number of PMTM primers: 4
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103343969 NCBI Gene Symbol: LOC103343969 |
| Gene Aliases | |
| Gene description & Other designations | Description: (3S;6E)-nerolidol synthase 1-like Other designations: (3S;6E)-nerolidol synthase 1-like |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 103343969 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (AGAGG)2 |
| Repeat start & end within CDS | Repeat start: 951 Repeat end: 960 |
| Forward primer | Primer sequence: GGAAAGAGCTGGGATTGGCT Tm(°C): 60.034 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: AGAGTGTAACGGGTTCCAGC Tm(°C): 59.679 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 850 End: 1190 Product size (bp): 341 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103343969 NCBI Gene Symbol: LOC103343969 |
| Gene Aliases | |
| Gene description & Other designations | Description: (3S;6E)-nerolidol synthase 1-like Other designations: (3S;6E)-nerolidol synthase 1-like |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 103343969 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tri Repeat sequence: (GCA)3 |
| Repeat start & end within CDS | Repeat start: 1408 Repeat end: 1416 |
| Forward primer | Primer sequence: TGGGGTGAATGTGGTGATGG Tm(°C): 59.961 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TATGTATGAGCCGTCGTGCC Tm(°C): 59.968 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 1304 End: 1487 Product size (bp): 184 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103343969 NCBI Gene Symbol: LOC103343969 |
| Gene Aliases | |
| Gene description & Other designations | Description: (3S;6E)-nerolidol synthase 1-like Other designations: (3S;6E)-nerolidol synthase 1-like |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 103343969 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: AAGGAGCACTGCCCAAGATC Tm(°C): 60.035 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GCCGTTGAACAGCATCGATC Tm(°C): 59.973 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 92 End: 300 Product size (bp): 209 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103324596 NCBI Gene Symbol: LOC103324596 |
| Gene Aliases | |
| Gene description & Other designations | Description: (3S;6E)-nerolidol synthase 1-like Other designations: (3S;6E)-nerolidol synthase 1-like |
| Chromosome, Strand & Exon count | Chromosome: LG3 Strand: plus Exon count: 7 |
| Gene Location within genomic sequence | Genomic accession No. NC_024128.1 Gene Start and end within genomic accession: 1294567 ...... 1297014 |
| CDS Sequence | 103324596 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (AGAGG)2 |
| Repeat start & end within CDS | Repeat start: 951 Repeat end: 960 |
| Forward primer | Primer sequence: GGAAAGAGCTGGGATTGGCT Tm(°C): 60.034 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: AGAGTGTAACGGGTTCCAGC Tm(°C): 59.679 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 850 End: 1190 Product size (bp): 341 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 103324596 NCBI Gene Symbol: LOC103324596 |
| Gene Aliases | |
| Gene description & Other designations | Description: (3S;6E)-nerolidol synthase 1-like Other designations: (3S;6E)-nerolidol synthase 1-like |
| Chromosome, Strand & Exon count | Chromosome: LG3 Strand: plus Exon count: 7 |
| Gene Location within genomic sequence | Genomic accession No. NC_024128.1 Gene Start and end within genomic accession: 1294567 ...... 1297014 |
| CDS Sequence | 103324596 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tri Repeat sequence: (GCA)3 |
| Repeat start & end within CDS | Repeat start: 1408 Repeat end: 1416 |
| Forward primer | Primer sequence: TGGGGTGAATGTGGTGATGG Tm(°C): 59.961 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TATGTATGAGCCGTCGTGCC Tm(°C): 59.968 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 1304 End: 1487 Product size (bp): 184 |
| JBrowse View | JBrowse |
