Statistics
Number of enzymes: 1
Total Number of designed primers: 5
Number of PGTM primers: 2
Number of PMTM primers: 3
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101247221 NCBI Gene Symbol: LOC101247221 |
| Gene Aliases | |
| Gene description & Other designations | Description: chlorophyll(ide) b reductase NOL; chloroplastic Other designations: chlorophyll(ide) b reductase NOL; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: 5 Strand: plus Exon count: 13 |
| Gene Location within genomic sequence | Genomic accession No. NC_015442.3 Gene Start and end within genomic accession: 46272520 ...... 46287670 |
| CDS Sequence | 101247221 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Compound Repeat sequence: (CTTCA)2atcctttcctaaatcacttctctg(CT)4 |
| Repeat start & end within CDS | Repeat start: 26 Repeat end: 67 |
| Forward primer | Primer sequence: TGAAATGAGTGTTACCACCGC Tm(°C): 58.852 GC (%): 47.619 Size: 21 |
| Reverse primer | Primer sequence: GTGTGGAGAAGAAGCAGCCT Tm(°C): 59.964 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 5 End: 197 Product size (bp): 193 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101247221 NCBI Gene Symbol: LOC101247221 |
| Gene Aliases | |
| Gene description & Other designations | Description: chlorophyll(ide) b reductase NOL; chloroplastic Other designations: chlorophyll(ide) b reductase NOL; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: 5 Strand: plus Exon count: 13 |
| Gene Location within genomic sequence | Genomic accession No. NC_015442.3 Gene Start and end within genomic accession: 46272520 ...... 46287670 |
| CDS Sequence | 101247221 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Compound Repeat sequence: (AATTC)2(GTTTC)2t(CTG)3 |
| Repeat start & end within CDS | Repeat start: 143 Repeat end: 172 |
| Forward primer | Primer sequence: TGAGTGTTACCACCGCTTCA Tm(°C): 59.246 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: GTGTGGAGAAGAAGCAGCCT Tm(°C): 59.964 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 10 End: 197 Product size (bp): 188 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101247221 NCBI Gene Symbol: LOC101247221 |
| Gene Aliases | |
| Gene description & Other designations | Description: chlorophyll(ide) b reductase NOL; chloroplastic Other designations: chlorophyll(ide) b reductase NOL; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: 5 Strand: plus Exon count: 13 |
| Gene Location within genomic sequence | Genomic accession No. NC_015442.3 Gene Start and end within genomic accession: 46272520 ...... 46287670 |
| CDS Sequence | 101247221 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (CAGAT)2 |
| Repeat start & end within CDS | Repeat start: 321 Repeat end: 330 |
| Forward primer | Primer sequence: AGGCTGCTTCTTCTCCACAC Tm(°C): 59.964 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: ACACATGCTGCTTCCCTGTT Tm(°C): 60.179 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 178 End: 387 Product size (bp): 210 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101247221 NCBI Gene Symbol: LOC101247221 |
| Gene Aliases | |
| Gene description & Other designations | Description: chlorophyll(ide) b reductase NOL; chloroplastic Other designations: chlorophyll(ide) b reductase NOL; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: 5 Strand: plus Exon count: 13 |
| Gene Location within genomic sequence | Genomic accession No. NC_015442.3 Gene Start and end within genomic accession: 46272520 ...... 46287670 |
| CDS Sequence | 101247221 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: TAGCTTCAAACCCCTGGCAG Tm(°C): 59.962 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GGGGGTTGGTCTTCCATCTG Tm(°C): 60.034 GC (%): 60 Size: 20 |
| Primer start, end within sequence and product size | Start: 515 End: 689 Product size (bp): 175 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101258872 NCBI Gene Symbol: LOC101258872 |
| Gene Aliases | |
| Gene description & Other designations | Description: probable chlorophyll(ide) b reductase NYC1; chloroplastic Other designations: probable chlorophyll(ide) b reductase NYC1; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: 7 Strand: plus Exon count: 9 |
| Gene Location within genomic sequence | Genomic accession No. NC_015444.3 Gene Start and end within genomic accession: 23790813 ...... 23795543 |
| CDS Sequence | 101258872 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: TTCGACCCTTGCTGGAGTTC Tm(°C): 59.965 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CCAGAACCTGCACCATCCAT Tm(°C): 60.034 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 784 End: 937 Product size (bp): 154 |
| JBrowse View | JBrowse |
