Statistics
Number of enzymes: 1
Total Number of designed primers: 2
Number of PGTM primers: 1
Number of PMTM primers: 1
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 108219296 NCBI Gene Symbol: LOC108219296 |
| Gene Aliases | DCAR_014388 |
| Gene description & Other designations | Description: chlorophyllide a oxygenase; chloroplastic Other designations: chlorophyllide a oxygenase; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: 4 Strand: plus Exon count: 9 |
| Gene Location within genomic sequence | Genomic accession No. NC_030384.1 Gene Start and end within genomic accession: 22247362 ...... 22251995 |
| CDS Sequence | 108219296 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (ACAAG)2 |
| Repeat start & end within CDS | Repeat start: 1340 Repeat end: 1349 |
| Forward primer | Primer sequence: GGAACACGGGCTCCTCTTAG Tm(°C): 59.824 GC (%): 60 Size: 20 |
| Reverse primer | Primer sequence: GGGAGCAAAATCCAGGGACA Tm(°C): 59.96 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 1049 End: 1382 Product size (bp): 334 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 108219296 NCBI Gene Symbol: LOC108219296 |
| Gene Aliases | DCAR_014388 |
| Gene description & Other designations | Description: chlorophyllide a oxygenase; chloroplastic Other designations: chlorophyllide a oxygenase; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: 4 Strand: plus Exon count: 9 |
| Gene Location within genomic sequence | Genomic accession No. NC_030384.1 Gene Start and end within genomic accession: 22247362 ...... 22251995 |
| CDS Sequence | 108219296 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: GGGTTGGTGCTGCTGTAGAT Tm(°C): 60.035 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TCTCGCAAGTGCCATCTGTT Tm(°C): 59.965 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 439 End: 876 Product size (bp): 438 |
| JBrowse View | JBrowse |
