Statistics
Number of enzymes: 1
Total Number of designed primers: 3
Number of PGTM primers: 2
Number of PMTM primers: 1
Number of Failed designed PMTM primers: 2
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101261422 NCBI Gene Symbol: LOC101261422 |
| Gene Aliases | |
| Gene description & Other designations | Description: chlorophyllide a oxygenase; chloroplastic Other designations: chlorophyllide a oxygenase; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: 6 Strand: minus Exon count: 9 |
| Gene Location within genomic sequence | Genomic accession No. NC_015443.3 Gene Start and end within genomic accession: 38400173 ...... 38404124 |
| CDS Sequence | 101261422 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Hexa Repeat sequence: (GATATG)2 |
| Repeat start & end within CDS | Repeat start: 951 Repeat end: 962 |
| Forward primer | Primer sequence: TCCGGAACACATGTGCACAT Tm(°C): 60.251 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: TGTATGGGTGAAAGGCGCAT Tm(°C): 60.035 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 769 End: 1115 Product size (bp): 347 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101261422 NCBI Gene Symbol: LOC101261422 |
| Gene Aliases | |
| Gene description & Other designations | Description: chlorophyllide a oxygenase; chloroplastic Other designations: chlorophyllide a oxygenase; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: 6 Strand: minus Exon count: 9 |
| Gene Location within genomic sequence | Genomic accession No. NC_015443.3 Gene Start and end within genomic accession: 38400173 ...... 38404124 |
| CDS Sequence | 101261422 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (AGCAA)2 |
| Repeat start & end within CDS | Repeat start: 1581 Repeat end: 1590 |
| Forward primer | Primer sequence: None Tm(°C): GC (%): Size: |
| Reverse primer | Primer sequence: None Tm(°C): GC (%): Size: |
| Primer start, end within sequence and product size | Start: End: Product size (bp): |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101261422 NCBI Gene Symbol: LOC101261422 |
| Gene Aliases | |
| Gene description & Other designations | Description: chlorophyllide a oxygenase; chloroplastic Other designations: chlorophyllide a oxygenase; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: 6 Strand: minus Exon count: 9 |
| Gene Location within genomic sequence | Genomic accession No. NC_015443.3 Gene Start and end within genomic accession: 38400173 ...... 38404124 |
| CDS Sequence | 101261422 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: CCTGCACGAAAAGGTTGTGG Tm(°C): 59.969 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CAGAAACCCGCACCTCAGAT Tm(°C): 60.036 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 308 End: 453 Product size (bp): 146 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101244441 NCBI Gene Symbol: LOC101244441 |
| Gene Aliases | |
| Gene description & Other designations | Description: chlorophyllide a oxygenase; chloroplastic-like Other designations: chlorophyllide a oxygenase; chloroplastic-like |
| Chromosome, Strand & Exon count | Chromosome: 11 Strand: minus Exon count: 9 |
| Gene Location within genomic sequence | Genomic accession No. NC_015448.3 Gene Start and end within genomic accession: 5644034 ...... 5648371 |
| CDS Sequence | 101244441 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Hexa Repeat sequence: (TGCTAC)2 |
| Repeat start & end within CDS | Repeat start: 12 Repeat end: 23 |
| Forward primer | Primer sequence: None Tm(°C): GC (%): Size: |
| Reverse primer | Primer sequence: None Tm(°C): GC (%): Size: |
| Primer start, end within sequence and product size | Start: End: Product size (bp): |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101244441 NCBI Gene Symbol: LOC101244441 |
| Gene Aliases | |
| Gene description & Other designations | Description: chlorophyllide a oxygenase; chloroplastic-like Other designations: chlorophyllide a oxygenase; chloroplastic-like |
| Chromosome, Strand & Exon count | Chromosome: 11 Strand: minus Exon count: 9 |
| Gene Location within genomic sequence | Genomic accession No. NC_015448.3 Gene Start and end within genomic accession: 5644034 ...... 5648371 |
| CDS Sequence | 101244441 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: CCGACGGGAAGTGTGAGAAA Tm(°C): 59.967 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GGTGGATCATTTCCTGGCCA Tm(°C): 60.033 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 865 End: 979 Product size (bp): 115 |
| JBrowse View | JBrowse |
