Statistics
Number of enzymes: 1
Total Number of designed primers: 3
Number of PGTM primers: 1
Number of PMTM primers: 2
Number of Failed designed PMTM primers: 1
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 108192987 NCBI Gene Symbol: LOC108192987 |
| Gene Aliases | DCAR_021441 |
| Gene description & Other designations | Description: red chlorophyll catabolite reductase; chloroplastic Other designations: red chlorophyll catabolite reductase; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: 6 Strand: plus Exon count: 2 |
| Gene Location within genomic sequence | Genomic accession No. NC_030386.1 Gene Start and end within genomic accession: 22926757 ...... 22929158 |
| CDS Sequence | 108192987 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Compound Repeat sequence: (TC)4cctct(TTC)3 |
| Repeat start & end within CDS | Repeat start: 59 Repeat end: 80 |
| Forward primer | Primer sequence: TTTCACTCCTCTCCCTCCCG Tm(°C): 60.615 GC (%): 60 Size: 20 |
| Reverse primer | Primer sequence: ACTCTACATCCTGCGGGAGT Tm(°C): 60.033 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 33 End: 282 Product size (bp): 250 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 108192987 NCBI Gene Symbol: LOC108192987 |
| Gene Aliases | DCAR_021441 |
| Gene description & Other designations | Description: red chlorophyll catabolite reductase; chloroplastic Other designations: red chlorophyll catabolite reductase; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: 6 Strand: plus Exon count: 2 |
| Gene Location within genomic sequence | Genomic accession No. NC_030386.1 Gene Start and end within genomic accession: 22926757 ...... 22929158 |
| CDS Sequence | 108192987 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tri Repeat sequence: (CAT)3 |
| Repeat start & end within CDS | Repeat start: 142 Repeat end: 150 |
| Forward primer | Primer sequence: TCCTCCTCTACATCACCCGG Tm(°C): 60.106 GC (%): 60 Size: 20 |
| Reverse primer | Primer sequence: ACTCTACATCCTGCGGGAGT Tm(°C): 60.033 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 111 End: 282 Product size (bp): 172 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 108192987 NCBI Gene Symbol: LOC108192987 |
| Gene Aliases | DCAR_021441 |
| Gene description & Other designations | Description: red chlorophyll catabolite reductase; chloroplastic Other designations: red chlorophyll catabolite reductase; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: 6 Strand: plus Exon count: 2 |
| Gene Location within genomic sequence | Genomic accession No. NC_030386.1 Gene Start and end within genomic accession: 22926757 ...... 22929158 |
| CDS Sequence | 108192987 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tri Repeat sequence: (AGC)3 |
| Repeat start & end within CDS | Repeat start: 915 Repeat end: 923 |
| Forward primer | Primer sequence: None Tm(°C): GC (%): Size: |
| Reverse primer | Primer sequence: None Tm(°C): GC (%): Size: |
| Primer start, end within sequence and product size | Start: End: Product size (bp): |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 108192987 NCBI Gene Symbol: LOC108192987 |
| Gene Aliases | DCAR_021441 |
| Gene description & Other designations | Description: red chlorophyll catabolite reductase; chloroplastic Other designations: red chlorophyll catabolite reductase; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: 6 Strand: plus Exon count: 2 |
| Gene Location within genomic sequence | Genomic accession No. NC_030386.1 Gene Start and end within genomic accession: 22926757 ...... 22929158 |
| CDS Sequence | 108192987 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: TCCTCCTCTACATCACCCGG Tm(°C): 60.106 GC (%): 60 Size: 20 |
| Reverse primer | Primer sequence: ACTCTACATCCTGCGGGAGT Tm(°C): 60.033 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 111 End: 282 Product size (bp): 172 |
| JBrowse View | JBrowse |
