Statistics
Number of enzymes: 1
Total Number of designed primers: 2
Number of PGTM primers: 1
Number of PMTM primers: 1
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 778267 NCBI Gene Symbol: LOC778267 |
| Gene Aliases | rccr |
| Gene description & Other designations | Description: red chlorophyll catabolite reductase; chloroplastic Other designations: red chlorophyll catabolite reductase; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: 3 Strand: plus Exon count: 2 |
| Gene Location within genomic sequence | Genomic accession No. NC_015440.3 Gene Start and end within genomic accession: 9353792 ...... 9357403 |
| CDS Sequence | 778267 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tri Repeat sequence: (TCT)3 |
| Repeat start & end within CDS | Repeat start: 616 Repeat end: 624 |
| Forward primer | Primer sequence: TCACTGCAACTTACCCACCG Tm(°C): 60.25 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CATCAATGCGAATGGCCTGG Tm(°C): 59.968 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 359 End: 705 Product size (bp): 347 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 778267 NCBI Gene Symbol: LOC778267 |
| Gene Aliases | rccr |
| Gene description & Other designations | Description: red chlorophyll catabolite reductase; chloroplastic Other designations: red chlorophyll catabolite reductase; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: 3 Strand: plus Exon count: 2 |
| Gene Location within genomic sequence | Genomic accession No. NC_015440.3 Gene Start and end within genomic accession: 9353792 ...... 9357403 |
| CDS Sequence | 778267 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: TCACTGCAACTTACCCACCG Tm(°C): 60.25 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CATCAATGCGAATGGCCTGG Tm(°C): 59.968 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 359 End: 705 Product size (bp): 347 |
| JBrowse View | JBrowse |
