|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 111435614 NCBI Gene Symbol: LOC111435614 |
| Gene Aliases | |
| Gene description & Other designations | Description: NO-associated protein 1; chloroplastic/mitochondrial Other designations: NO-associated protein 1; chloroplastic/mitochondrial |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 111435614 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (TTACG)2 |
| Repeat start & end within CDS | Repeat start: 559 Repeat end: 568 |
| Forward primer | Primer sequence: TTATATGTGGGAGGTGCCGC Tm(°C): 59.892 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TGGATTCGCACCAGCAAGAT Tm(°C): 60.035 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 433 End: 656 Product size (bp): 224 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 111435614 NCBI Gene Symbol: LOC111435614 |
| Gene Aliases | |
| Gene description & Other designations | Description: NO-associated protein 1; chloroplastic/mitochondrial Other designations: NO-associated protein 1; chloroplastic/mitochondrial |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 111435614 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tri Repeat sequence: (AGG)3 |
| Repeat start & end within CDS | Repeat start: 1017 Repeat end: 1025 |
| Forward primer | Primer sequence: TGGGCTCAGCTAATGTTGGG Tm(°C): 60.034 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GCAGCTAGCCTATGGTGGAG Tm(°C): 59.965 GC (%): 60 Size: 20 |
| Primer start, end within sequence and product size | Start: 859 End: 1072 Product size (bp): 214 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 111435614 NCBI Gene Symbol: LOC111435614 |
| Gene Aliases | |
| Gene description & Other designations | Description: NO-associated protein 1; chloroplastic/mitochondrial Other designations: NO-associated protein 1; chloroplastic/mitochondrial |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 111435614 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Hexa Repeat sequence: (GAAGAG)2 |
| Repeat start & end within CDS | Repeat start: 1657 Repeat end: 1668 |
| Forward primer | Primer sequence: None Tm(°C): GC (%): Size: |
| Reverse primer | Primer sequence: None Tm(°C): GC (%): Size: |
| Primer start, end within sequence and product size | Start: End: Product size (bp): |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 111435614 NCBI Gene Symbol: LOC111435614 |
| Gene Aliases | |
| Gene description & Other designations | Description: NO-associated protein 1; chloroplastic/mitochondrial Other designations: NO-associated protein 1; chloroplastic/mitochondrial |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 111435614 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: TGGGCTCAGCTAATGTTGGG Tm(°C): 60.034 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GCAGCTAGCCTATGGTGGAG Tm(°C): 59.965 GC (%): 60 Size: 20 |
| Primer start, end within sequence and product size | Start: 859 End: 1072 Product size (bp): 214 |
| JBrowse View | JBrowse |
