Statistics
Number of enzymes: 1
Total Number of designed primers: 3
Number of PGTM primers: 2
Number of PMTM primers: 1
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 111456636 NCBI Gene Symbol: LOC111456636 |
| Gene Aliases | |
| Gene description & Other designations | Description: polyamine oxidase 1-like Other designations: polyamine oxidase 1-like |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 111456636 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Hexa Repeat sequence: (CGTCAT)2 |
| Repeat start & end within CDS | Repeat start: 24 Repeat end: 35 |
| Forward primer | Primer sequence: TGGATTCCCCTTCTCGTTCC Tm(°C): 59.09 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CAAGTTCCACCGATACGCCT Tm(°C): 60.108 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 1 End: 174 Product size (bp): 174 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 111456636 NCBI Gene Symbol: LOC111456636 |
| Gene Aliases | |
| Gene description & Other designations | Description: polyamine oxidase 1-like Other designations: polyamine oxidase 1-like |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 111456636 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: TGGTGTACTCCAAAGCGACC Tm(°C): 59.966 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GCTCGTGTGTTCTCCAGTGA Tm(°C): 59.968 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 746 End: 1238 Product size (bp): 493 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 111461207 NCBI Gene Symbol: LOC111461207 |
| Gene Aliases | |
| Gene description & Other designations | Description: polyamine oxidase 1-like Other designations: polyamine oxidase 1-like |
| Chromosome, Strand & Exon count | Chromosome: Un Strand: Exon count: |
| Gene Location within genomic sequence | Genomic accession No. Gene Start and end within genomic accession: ...... |
| CDS Sequence | 111461207 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: AACAGGTTCCAGCGTGGTAG Tm(°C): 59.965 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CGTGTGTTCTCCGGTGAAGA Tm(°C): 59.968 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 1122 End: 1232 Product size (bp): 111 |
| JBrowse View | JBrowse |
