image


Statistics

Number of enzymes: 1
Total Number of designed primers: 8
Number of PGTM primers:     1
Number of PMTM primers:     7

Enzyme Id:  K13098

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101251999     NCBI Gene Symbol: LOC101251999
Gene Aliases
Gene description & Other designations Description:   transcription initiation factor TFIID subunit 15b      Other designations:   transcription initiation factor TFIID subunit 15b
Chromosome, Strand & Exon count Chromosome:   6     Strand:   plus     Exon count:   7
Gene Location within genomic sequence Genomic accession No. NC_015443.3      Gene Start and end within genomic accession: 48181663 ...... 48186315
CDS Sequence 101251999
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GGT)3
Repeat start & end within CDS Repeat start: 103     Repeat end: 111
Forward primer Primer sequence:   GGCGGAGGATATGGTGGTTC     Tm(°C): 60.25     GC (%): 60     Size: 20
Reverse primer Primer sequence:   GGTATCCACCTCCACCTCCT     Tm(°C): 60.031     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 81     End: 225     Product size (bp): 145
JBrowse View      JBrowse

Enzyme Id:  K13098

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101251999     NCBI Gene Symbol: LOC101251999
Gene Aliases
Gene description & Other designations Description:   transcription initiation factor TFIID subunit 15b      Other designations:   transcription initiation factor TFIID subunit 15b
Chromosome, Strand & Exon count Chromosome:   6     Strand:   plus     Exon count:   7
Gene Location within genomic sequence Genomic accession No. NC_015443.3      Gene Start and end within genomic accession: 48181663 ...... 48186315
CDS Sequence 101251999
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (GGAGGT)2ggaggctatggtggtagctcccataatcga(GGAGGT)2
Repeat start & end within CDS Repeat start: 166     Repeat end: 219
Forward primer Primer sequence:   TGGTTCAGGTGGTGGTTACG     Tm(°C): 59.893     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TCCACGATCTCCTCCATGGT     Tm(°C): 60.032     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 95     End: 242     Product size (bp): 148
JBrowse View      JBrowse

Enzyme Id:  K13098

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101251999     NCBI Gene Symbol: LOC101251999
Gene Aliases
Gene description & Other designations Description:   transcription initiation factor TFIID subunit 15b      Other designations:   transcription initiation factor TFIID subunit 15b
Chromosome, Strand & Exon count Chromosome:   6     Strand:   plus     Exon count:   7
Gene Location within genomic sequence Genomic accession No. NC_015443.3      Gene Start and end within genomic accession: 48181663 ...... 48186315
CDS Sequence 101251999
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (GTGGCG)2
Repeat start & end within CDS Repeat start: 305     Repeat end: 316
Forward primer Primer sequence:   TGGAGGCTATGGTGGTAGCT     Tm(°C): 60.031     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TCCACCACTACCTCCACGAT     Tm(°C): 59.959     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 176     End: 353     Product size (bp): 178
JBrowse View      JBrowse

Enzyme Id:  K13098

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101251999     NCBI Gene Symbol: LOC101251999
Gene Aliases
Gene description & Other designations Description:   transcription initiation factor TFIID subunit 15b      Other designations:   transcription initiation factor TFIID subunit 15b
Chromosome, Strand & Exon count Chromosome:   6     Strand:   plus     Exon count:   7
Gene Location within genomic sequence Genomic accession No. NC_015443.3      Gene Start and end within genomic accession: 48181663 ...... 48186315
CDS Sequence 101251999
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GCG)3
Repeat start & end within CDS Repeat start: 380     Repeat end: 388
Forward primer Primer sequence:   TCGTGGAGGTAGTGGTGGAT     Tm(°C): 59.959     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CACCTCTTCCCCCTCGACTA     Tm(°C): 60.033     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 335     End: 594     Product size (bp): 260
JBrowse View      JBrowse

Enzyme Id:  K13098

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101251999     NCBI Gene Symbol: LOC101251999
Gene Aliases
Gene description & Other designations Description:   transcription initiation factor TFIID subunit 15b      Other designations:   transcription initiation factor TFIID subunit 15b
Chromosome, Strand & Exon count Chromosome:   6     Strand:   plus     Exon count:   7
Gene Location within genomic sequence Genomic accession No. NC_015443.3      Gene Start and end within genomic accession: 48181663 ...... 48186315
CDS Sequence 101251999
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (TGG)3
Repeat start & end within CDS Repeat start: 663     Repeat end: 671
Forward primer Primer sequence:   TAGTCGAGGGGGAAGAGGTG     Tm(°C): 60.033     GC (%): 60     Size: 20
Reverse primer Primer sequence:   TATCCCCACCATAGCCACCA     Tm(°C): 60.03     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 575     End: 849     Product size (bp): 275
JBrowse View      JBrowse

Enzyme Id:  K13098

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101251999     NCBI Gene Symbol: LOC101251999
Gene Aliases
Gene description & Other designations Description:   transcription initiation factor TFIID subunit 15b      Other designations:   transcription initiation factor TFIID subunit 15b
Chromosome, Strand & Exon count Chromosome:   6     Strand:   plus     Exon count:   7
Gene Location within genomic sequence Genomic accession No. NC_015443.3      Gene Start and end within genomic accession: 48181663 ...... 48186315
CDS Sequence 101251999
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Di     Repeat sequence: (AT)4
Repeat start & end within CDS Repeat start: 1024     Repeat end: 1031
Forward primer Primer sequence:   TGGTGGCTATGGTGGGGATA     Tm(°C): 60.03     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TTATGCTCCAAGGCCACTGG     Tm(°C): 60.034     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 830     End: 1149     Product size (bp): 320
JBrowse View      JBrowse

Enzyme Id:  K13098

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101251999     NCBI Gene Symbol: LOC101251999
Gene Aliases
Gene description & Other designations Description:   transcription initiation factor TFIID subunit 15b      Other designations:   transcription initiation factor TFIID subunit 15b
Chromosome, Strand & Exon count Chromosome:   6     Strand:   plus     Exon count:   7
Gene Location within genomic sequence Genomic accession No. NC_015443.3      Gene Start and end within genomic accession: 48181663 ...... 48186315
CDS Sequence 101251999
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (TGG)5
Repeat start & end within CDS Repeat start: 1350     Repeat end: 1364
Forward primer Primer sequence:   CCAGTGGCCTTGGAGCATAA     Tm(°C): 60.034     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CTGTCTATCTGGGCCGGAAC     Tm(°C): 59.895     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 1130     End: 1415     Product size (bp): 286
JBrowse View      JBrowse

Enzyme Id:  K13098

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101251999     NCBI Gene Symbol: LOC101251999
Gene Aliases
Gene description & Other designations Description:   transcription initiation factor TFIID subunit 15b      Other designations:   transcription initiation factor TFIID subunit 15b
Chromosome, Strand & Exon count Chromosome:   6     Strand:   plus     Exon count:   7
Gene Location within genomic sequence Genomic accession No. NC_015443.3      Gene Start and end within genomic accession: 48181663 ...... 48186315
CDS Sequence 101251999
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   TAGTCGAGGGGGAAGAGGTG     Tm(°C): 60.033     GC (%): 60     Size: 20
Reverse primer Primer sequence:   TATCCCCACCATAGCCACCA     Tm(°C): 60.03     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 575     End: 849     Product size (bp): 275
JBrowse View      JBrowse