Statistics
Number of enzymes: 1
Total Number of designed primers: 2
Number of PGTM primers: 1
Number of PMTM primers: 1
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 108192785 NCBI Gene Symbol: LOC108192785 |
| Gene Aliases | DCAR_022680 |
| Gene description & Other designations | Description: pheophorbide a oxygenase; chloroplastic Other designations: pheophorbide a oxygenase; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: 6 Strand: plus Exon count: 7 |
| Gene Location within genomic sequence | Genomic accession No. NC_030386.1 Gene Start and end within genomic accession: 8270438 ...... 8276503 |
| CDS Sequence | 108192785 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Compound Repeat sequence: (CATCTT)2cgtcttcat(CAA)3atcccccccaagacacta(AAG)3 |
| Repeat start & end within CDS | Repeat start: 155 Repeat end: 211 |
| Forward primer | Primer sequence: CCCAGCCAAATCCCTCTTGT Tm(°C): 59.96 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: ATCACGGTTGAGCAGCTGAA Tm(°C): 59.965 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 61 End: 320 Product size (bp): 260 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 108192785 NCBI Gene Symbol: LOC108192785 |
| Gene Aliases | DCAR_022680 |
| Gene description & Other designations | Description: pheophorbide a oxygenase; chloroplastic Other designations: pheophorbide a oxygenase; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: 6 Strand: plus Exon count: 7 |
| Gene Location within genomic sequence | Genomic accession No. NC_030386.1 Gene Start and end within genomic accession: 8270438 ...... 8276503 |
| CDS Sequence | 108192785 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: TTCAGCTGCTCAACCGTGAT Tm(°C): 59.965 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: ATCCTCGTACAAGACCCGGA Tm(°C): 60.034 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 301 End: 484 Product size (bp): 184 |
| JBrowse View | JBrowse |
