Statistics
Number of enzymes: 1
Total Number of designed primers: 3
Number of PGTM primers: 1
Number of PMTM primers: 2
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 543677 NCBI Gene Symbol: LOC543677 |
| Gene Aliases | |
| Gene description & Other designations | Description: lethal leaf spot 1-like protein Other designations: lethal leaf spot 1-like protein|LLS1-like protein |
| Chromosome, Strand & Exon count | Chromosome: 11 Strand: minus Exon count: 7 |
| Gene Location within genomic sequence | Genomic accession No. NC_015448.3 Gene Start and end within genomic accession: 52495422 ...... 52499145 |
| CDS Sequence | 543677 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Compound Repeat sequence: (CAA)4cagctact(GAA)3(AGAAG)2* |
| Repeat start & end within CDS | Repeat start: 152 Repeat end: 186 |
| Forward primer | Primer sequence: TCCTCTTAGAGTAGCTGCACCT Tm(°C): 60.025 GC (%): 50 Size: 22 |
| Reverse primer | Primer sequence: TCGGGTCGAGATCTTCCACT Tm(°C): 60.034 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 128 End: 303 Product size (bp): 176 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 543677 NCBI Gene Symbol: LOC543677 |
| Gene Aliases | |
| Gene description & Other designations | Description: lethal leaf spot 1-like protein Other designations: lethal leaf spot 1-like protein|LLS1-like protein |
| Chromosome, Strand & Exon count | Chromosome: 11 Strand: minus Exon count: 7 |
| Gene Location within genomic sequence | Genomic accession No. NC_015448.3 Gene Start and end within genomic accession: 52495422 ...... 52499145 |
| CDS Sequence | 543677 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tri Repeat sequence: (TCG)3 |
| Repeat start & end within CDS | Repeat start: 238 Repeat end: 246 |
| Forward primer | Primer sequence: GCTGCACCTCCAACAACAAC Tm(°C): 60.249 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TCGGGTCGAGATCTTCCACT Tm(°C): 60.034 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 141 End: 303 Product size (bp): 163 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 543677 NCBI Gene Symbol: LOC543677 |
| Gene Aliases | |
| Gene description & Other designations | Description: lethal leaf spot 1-like protein Other designations: lethal leaf spot 1-like protein|LLS1-like protein |
| Chromosome, Strand & Exon count | Chromosome: 11 Strand: minus Exon count: 7 |
| Gene Location within genomic sequence | Genomic accession No. NC_015448.3 Gene Start and end within genomic accession: 52495422 ...... 52499145 |
| CDS Sequence | 543677 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: AGATGGAGGCATCTGGACCT Tm(°C): 60.03 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CTGGTCTTTCCTGGTGCCAT Tm(°C): 59.961 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 823 End: 1015 Product size (bp): 193 |
| JBrowse View | JBrowse |
