Statistics
Number of enzymes: 1
Total Number of designed primers: 2
Number of PGTM primers: 1
Number of PMTM primers: 1
Number of Failed designed PMTM primers: 1
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101268545 NCBI Gene Symbol: LOC101268545 |
| Gene Aliases | |
| Gene description & Other designations | Description: nuclear cap-binding protein subunit 2 Other designations: nuclear cap-binding protein subunit 2 |
| Chromosome, Strand & Exon count | Chromosome: 2 Strand: minus Exon count: 9 |
| Gene Location within genomic sequence | Genomic accession No. NC_015439.3 Gene Start and end within genomic accession: 34895233 ...... 34912219 |
| CDS Sequence | 101268545 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Hexa Repeat sequence: (TTGATT)2 |
| Repeat start & end within CDS | Repeat start: 320 Repeat end: 331 |
| Forward primer | Primer sequence: TGAGCTGTTCTCTCGTGCTG Tm(°C): 60.039 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GCCCCATTGCCTACCTTCTT Tm(°C): 60.033 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 152 End: 359 Product size (bp): 208 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101268545 NCBI Gene Symbol: LOC101268545 |
| Gene Aliases | |
| Gene description & Other designations | Description: nuclear cap-binding protein subunit 2 Other designations: nuclear cap-binding protein subunit 2 |
| Chromosome, Strand & Exon count | Chromosome: 2 Strand: minus Exon count: 9 |
| Gene Location within genomic sequence | Genomic accession No. NC_015439.3 Gene Start and end within genomic accession: 34895233 ...... 34912219 |
| CDS Sequence | 101268545 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tri Repeat sequence: (GAT)4 |
| Repeat start & end within CDS | Repeat start: 739 Repeat end: 750 |
| Forward primer | Primer sequence: None Tm(°C): GC (%): Size: |
| Reverse primer | Primer sequence: None Tm(°C): GC (%): Size: |
| Primer start, end within sequence and product size | Start: End: Product size (bp): |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101268545 NCBI Gene Symbol: LOC101268545 |
| Gene Aliases | |
| Gene description & Other designations | Description: nuclear cap-binding protein subunit 2 Other designations: nuclear cap-binding protein subunit 2 |
| Chromosome, Strand & Exon count | Chromosome: 2 Strand: minus Exon count: 9 |
| Gene Location within genomic sequence | Genomic accession No. NC_015439.3 Gene Start and end within genomic accession: 34895233 ...... 34912219 |
| CDS Sequence | 101268545 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: AAGAAGGTAGGCAATGGGGC Tm(°C): 60.033 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CGATAAGAGCCTCCACGACC Tm(°C): 59.969 GC (%): 60 Size: 20 |
| Primer start, end within sequence and product size | Start: 340 End: 574 Product size (bp): 235 |
| JBrowse View | JBrowse |
