image


Statistics

Number of enzymes: 1
Total Number of designed primers: 13
Number of PGTM primers:     4
Number of PMTM primers:     9

Enzyme Id:  K12881
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101256343     NCBI Gene Symbol: LOC101256343
Gene Aliases
Gene description & Other designations Description:   THO complex subunit 4D      Other designations:   THO complex subunit 4D
Chromosome, Strand & Exon count Chromosome:   11     Strand:   minus     Exon count:   7
Gene Location within genomic sequence Genomic accession No. NC_015448.3      Gene Start and end within genomic accession: 4210240 ...... 4215621
CDS Sequence 101256343
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (ATGAT)2
Repeat start & end within CDS Repeat start: 26     Repeat end: 35
Forward primer Primer sequence:   TGGCTTCACTGGATATGACCC     Tm(°C): 59.51     GC (%): 52.381     Size: 21
Reverse primer Primer sequence:   CCCTGTTGTCCTTCCACCTC     Tm(°C): 59.963     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 1     End: 149     Product size (bp): 149
JBrowse View      JBrowse

Enzyme Id:  K12881
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101256343     NCBI Gene Symbol: LOC101256343
Gene Aliases
Gene description & Other designations Description:   THO complex subunit 4D      Other designations:   THO complex subunit 4D
Chromosome, Strand & Exon count Chromosome:   11     Strand:   minus     Exon count:   7
Gene Location within genomic sequence Genomic accession No. NC_015448.3      Gene Start and end within genomic accession: 4210240 ...... 4215621
CDS Sequence 101256343
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GGA)3
Repeat start & end within CDS Repeat start: 590     Repeat end: 598
Forward primer Primer sequence:   GCAGTTGGATGGGAAGCCTA     Tm(°C): 59.744     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GCTGCTACTTCCCCTACCAC     Tm(°C): 59.822     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 494     End: 770     Product size (bp): 277
JBrowse View      JBrowse

Enzyme Id:  K12881
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101256343     NCBI Gene Symbol: LOC101256343
Gene Aliases
Gene description & Other designations Description:   THO complex subunit 4D      Other designations:   THO complex subunit 4D
Chromosome, Strand & Exon count Chromosome:   11     Strand:   minus     Exon count:   7
Gene Location within genomic sequence Genomic accession No. NC_015448.3      Gene Start and end within genomic accession: 4210240 ...... 4215621
CDS Sequence 101256343
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GGT)3
Repeat start & end within CDS Repeat start: 709     Repeat end: 717
Forward primer Primer sequence:   CGTGGAAGAGGAGCTGCTAC     Tm(°C): 60.179     GC (%): 60     Size: 20
Reverse primer Primer sequence:   GCTGCTACTTCCCCTACCAC     Tm(°C): 59.822     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 627     End: 770     Product size (bp): 144
JBrowse View      JBrowse

Enzyme Id:  K12881
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101256343     NCBI Gene Symbol: LOC101256343
Gene Aliases
Gene description & Other designations Description:   THO complex subunit 4D      Other designations:   THO complex subunit 4D
Chromosome, Strand & Exon count Chromosome:   11     Strand:   minus     Exon count:   7
Gene Location within genomic sequence Genomic accession No. NC_015448.3      Gene Start and end within genomic accession: 4210240 ...... 4215621
CDS Sequence 101256343
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   GAGGTGGAAGGACAACAGGG     Tm(°C): 59.963     GC (%): 60     Size: 20
Reverse primer Primer sequence:   TGATGACAGTCCTGCAGCTC     Tm(°C): 59.751     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 130     End: 287     Product size (bp): 158
JBrowse View      JBrowse

Enzyme Id:  K12881
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101262878     NCBI Gene Symbol: LOC101262878
Gene Aliases
Gene description & Other designations Description:   THO complex subunit 4A      Other designations:   THO complex subunit 4A
Chromosome, Strand & Exon count Chromosome:   10     Strand:   plus     Exon count:   5
Gene Location within genomic sequence Genomic accession No. NC_015447.3      Gene Start and end within genomic accession: 65353821 ...... 65358773
CDS Sequence 101262878
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (GGTCCA)2
Repeat start & end within CDS Repeat start: 97     Repeat end: 108
Forward primer Primer sequence:   CCTAGACCCAGAACAACCGG     Tm(°C): 59.751     GC (%): 60     Size: 20
Reverse primer Primer sequence:   CAGGTCTTCGGACAGACGAC     Tm(°C): 60.11     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 66     End: 228     Product size (bp): 163
JBrowse View      JBrowse

Enzyme Id:  K12881
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101262878     NCBI Gene Symbol: LOC101262878
Gene Aliases
Gene description & Other designations Description:   THO complex subunit 4A      Other designations:   THO complex subunit 4A
Chromosome, Strand & Exon count Chromosome:   10     Strand:   plus     Exon count:   5
Gene Location within genomic sequence Genomic accession No. NC_015447.3      Gene Start and end within genomic accession: 65353821 ...... 65358773
CDS Sequence 101262878
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (AAATCC)2tgctacaagaagtcaacaaagaggtggtggatttagccgtcctcga
(GGT)4
Repeat start & end within CDS Repeat start: 534     Repeat end: 603
Forward primer Primer sequence:   CCAGCTCTTCCTCCCATTCG     Tm(°C): 60.179     GC (%): 60     Size: 20
Reverse primer Primer sequence:   TTGTCTGCATGGCTTCTGCA     Tm(°C): 60.538     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 498     End: 714     Product size (bp): 217
JBrowse View      JBrowse

Enzyme Id:  K12881
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101262878     NCBI Gene Symbol: LOC101262878
Gene Aliases
Gene description & Other designations Description:   THO complex subunit 4A      Other designations:   THO complex subunit 4A
Chromosome, Strand & Exon count Chromosome:   10     Strand:   plus     Exon count:   5
Gene Location within genomic sequence Genomic accession No. NC_015447.3      Gene Start and end within genomic accession: 65353821 ...... 65358773
CDS Sequence 101262878
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   GTCGTCTGTCCGAAGACCTG     Tm(°C): 60.11     GC (%): 60     Size: 20
Reverse primer Primer sequence:   CCTCGAGGACGGCTAAATCC     Tm(°C): 59.968     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 209     End: 592     Product size (bp): 384
JBrowse View      JBrowse

Enzyme Id:  K12881
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101266904     NCBI Gene Symbol: LOC101266904
Gene Aliases
Gene description & Other designations Description:   RNA-binding (RRM/RBD/RNP motifs) family protein      Other designations:   RNA-binding (RRM/RBD/RNP motifs) family protein|THO complex subunit 4A
Chromosome, Strand & Exon count Chromosome:   11     Strand:   plus     Exon count:   5
Gene Location within genomic sequence Genomic accession No. NC_015448.3      Gene Start and end within genomic accession: 56582039 ...... 56586114
CDS Sequence 101266904
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (CCTCCA)2
Repeat start & end within CDS Repeat start: 98     Repeat end: 109
Forward primer Primer sequence:   TGAGGCAGCTTTGGATATGACT     Tm(°C): 59.493     GC (%): 45.455     Size: 22
Reverse primer Primer sequence:   CTCTATGGAAGACGCCCGAC     Tm(°C): 59.969     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 5     End: 266     Product size (bp): 262
JBrowse View      JBrowse

Enzyme Id:  K12881
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101266904     NCBI Gene Symbol: LOC101266904
Gene Aliases
Gene description & Other designations Description:   RNA-binding (RRM/RBD/RNP motifs) family protein      Other designations:   RNA-binding (RRM/RBD/RNP motifs) family protein|THO complex subunit 4A
Chromosome, Strand & Exon count Chromosome:   11     Strand:   plus     Exon count:   5
Gene Location within genomic sequence Genomic accession No. NC_015448.3      Gene Start and end within genomic accession: 56582039 ...... 56586114
CDS Sequence 101266904
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (TTTTGG)2agatactaatggagctcctagaagtggtcaagtaaga(GGT)3
Repeat start & end within CDS Repeat start: 546     Repeat end: 603
Forward primer Primer sequence:   GCGGGAGATCAAAGGGAACA     Tm(°C): 60.035     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ACCTCCTCTTCCCCATCCTC     Tm(°C): 60.031     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 382     End: 677     Product size (bp): 296
JBrowse View      JBrowse

Enzyme Id:  K12881
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101266904     NCBI Gene Symbol: LOC101266904
Gene Aliases
Gene description & Other designations Description:   RNA-binding (RRM/RBD/RNP motifs) family protein      Other designations:   RNA-binding (RRM/RBD/RNP motifs) family protein|THO complex subunit 4A
Chromosome, Strand & Exon count Chromosome:   11     Strand:   plus     Exon count:   5
Gene Location within genomic sequence Genomic accession No. NC_015448.3      Gene Start and end within genomic accession: 56582039 ...... 56586114
CDS Sequence 101266904
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   CGGGCGTCTTCCATAGAGAC     Tm(°C): 59.969     GC (%): 60     Size: 20
Reverse primer Primer sequence:   ACCTCCTCTTCCCCATCCTC     Tm(°C): 60.031     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 249     End: 677     Product size (bp): 429
JBrowse View      JBrowse

Enzyme Id:  K12881
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101268859     NCBI Gene Symbol: LOC101268859
Gene Aliases
Gene description & Other designations Description:   THO complex subunit 4D-like      Other designations:   THO complex subunit 4D-like
Chromosome, Strand & Exon count Chromosome:   4     Strand:   plus     Exon count:   8
Gene Location within genomic sequence Genomic accession No. NC_015441.3      Gene Start and end within genomic accession: 4689942 ...... 4695836
CDS Sequence 101268859
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (ATGAT)2
Repeat start & end within CDS Repeat start: 26     Repeat end: 35
Forward primer Primer sequence:   TGGCTTCCTTGGATATGTCTCT     Tm(°C): 58.612     GC (%): 45.455     Size: 22
Reverse primer Primer sequence:   ATGGCCGAGCATTTACACCA     Tm(°C): 60.035     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 1     End: 174     Product size (bp): 174
JBrowse View      JBrowse

Enzyme Id:  K12881
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101268859     NCBI Gene Symbol: LOC101268859
Gene Aliases
Gene description & Other designations Description:   THO complex subunit 4D-like      Other designations:   THO complex subunit 4D-like
Chromosome, Strand & Exon count Chromosome:   4     Strand:   plus     Exon count:   8
Gene Location within genomic sequence Genomic accession No. NC_015441.3      Gene Start and end within genomic accession: 4689942 ...... 4695836
CDS Sequence 101268859
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (CGTGGA)2ggacgcggtcgtggt(GGTAGG)2
Repeat start & end within CDS Repeat start: 697     Repeat end: 735
Forward primer Primer sequence:   GTTTTCGCCAGGAGGAGTGA     Tm(°C): 59.965     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCGACTTCTCAACGCCATTC     Tm(°C): 59.278     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 426     End: 756     Product size (bp): 331
JBrowse View      JBrowse

Enzyme Id:  K12881
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101268859     NCBI Gene Symbol: LOC101268859
Gene Aliases
Gene description & Other designations Description:   THO complex subunit 4D-like      Other designations:   THO complex subunit 4D-like
Chromosome, Strand & Exon count Chromosome:   4     Strand:   plus     Exon count:   8
Gene Location within genomic sequence Genomic accession No. NC_015441.3      Gene Start and end within genomic accession: 4689942 ...... 4695836
CDS Sequence 101268859
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   TGGTGTAAATGCTCGGCCAT     Tm(°C): 60.035     GC (%): 50     Size: 20
Reverse primer Primer sequence:   TCACTCCTCCTGGCGAAAAC     Tm(°C): 59.965     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 155     End: 445     Product size (bp): 291
JBrowse View      JBrowse