|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101268456 NCBI Gene Symbol: LOC101268456 |
| Gene Aliases | |
| Gene description & Other designations | Description: protein mago nashi homolog Other designations: protein mago nashi homolog|mago nashi protein |
| Chromosome, Strand & Exon count | Chromosome: 3 Strand: plus Exon count: 3 |
| Gene Location within genomic sequence | Genomic accession No. NC_015440.3 Gene Start and end within genomic accession: 56745375 ...... 56749536 |
| CDS Sequence | 101268456 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Di Repeat sequence: (TC)4 |
| Repeat start & end within CDS | Repeat start: 416 Repeat end: 423 |
| Forward primer | Primer sequence: ATGGCAAGCTCCGTTATGCT Tm(°C): 60.107 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: GGTTTGATCTTGAAATGGAGCG Tm(°C): 58.237 GC (%): 45.455 Size: 22 |
| Primer start, end within sequence and product size | Start: 100 End: 448 Product size (bp): 349 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101268456 NCBI Gene Symbol: LOC101268456 |
| Gene Aliases | |
| Gene description & Other designations | Description: protein mago nashi homolog Other designations: protein mago nashi homolog|mago nashi protein |
| Chromosome, Strand & Exon count | Chromosome: 3 Strand: plus Exon count: 3 |
| Gene Location within genomic sequence | Genomic accession No. NC_015440.3 Gene Start and end within genomic accession: 56745375 ...... 56749536 |
| CDS Sequence | 101268456 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: GGGGAAATGGCGGAGAATGA Tm(°C): 60.107 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: AGCATAACGGAGCTTGCCAT Tm(°C): 60.107 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 3 End: 119 Product size (bp): 117 |
| JBrowse View | JBrowse |
