image


Statistics

Number of enzymes: 1
Total Number of designed primers: 4
Number of PGTM primers:     1
Number of PMTM primers:     3

Enzyme Id:  K12876
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101248886     NCBI Gene Symbol: LOC101248886
Gene Aliases
Gene description & Other designations Description:   RNA-binding protein 8A-like      Other designations:   RNA-binding protein 8A-like|RNA-binding protein 8A
Chromosome, Strand & Exon count Chromosome:   6     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_015443.3      Gene Start and end within genomic accession: 40982701 ...... 40987123
CDS Sequence 101248886
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GGC)3
Repeat start & end within CDS Repeat start: 121     Repeat end: 129
Forward primer Primer sequence:   CGAGCCAGAGGAAGACGATC     Tm(°C): 59.97     GC (%): 60     Size: 20
Reverse primer Primer sequence:   CGTGTGCCTCCTCATTGACT     Tm(°C): 60.037     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 29     End: 309     Product size (bp): 281
JBrowse View      JBrowse

Enzyme Id:  K12876
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101248886     NCBI Gene Symbol: LOC101248886
Gene Aliases
Gene description & Other designations Description:   RNA-binding protein 8A-like      Other designations:   RNA-binding protein 8A-like|RNA-binding protein 8A
Chromosome, Strand & Exon count Chromosome:   6     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_015443.3      Gene Start and end within genomic accession: 40982701 ...... 40987123
CDS Sequence 101248886
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Di     Repeat sequence: (AG)4
Repeat start & end within CDS Repeat start: 435     Repeat end: 442
Forward primer Primer sequence:   AGTCAATGAGGAGGCACACG     Tm(°C): 60.037     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AGGACCTTTGCTGAATGCCC     Tm(°C): 60.613     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 290     End: 515     Product size (bp): 226
JBrowse View      JBrowse

Enzyme Id:  K12876
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101248886     NCBI Gene Symbol: LOC101248886
Gene Aliases
Gene description & Other designations Description:   RNA-binding protein 8A-like      Other designations:   RNA-binding protein 8A-like|RNA-binding protein 8A
Chromosome, Strand & Exon count Chromosome:   6     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_015443.3      Gene Start and end within genomic accession: 40982701 ...... 40987123
CDS Sequence 101248886
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (AGG)3
Repeat start & end within CDS Repeat start: 535     Repeat end: 543
Forward primer Primer sequence:   AGTCAATGAGGAGGCACACG     Tm(°C): 60.037     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCTCCTGGGACTTCTAGAACG     Tm(°C): 59.248     GC (%): 57.143     Size: 21
Primer start, end within sequence and product size Start: 290     End: 578     Product size (bp): 289
JBrowse View      JBrowse

Enzyme Id:  K12876
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101248886     NCBI Gene Symbol: LOC101248886
Gene Aliases
Gene description & Other designations Description:   RNA-binding protein 8A-like      Other designations:   RNA-binding protein 8A-like|RNA-binding protein 8A
Chromosome, Strand & Exon count Chromosome:   6     Strand:   minus     Exon count:   4
Gene Location within genomic sequence Genomic accession No. NC_015443.3      Gene Start and end within genomic accession: 40982701 ...... 40987123
CDS Sequence 101248886
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   CGAGCCAGAGGAAGACGATC     Tm(°C): 59.97     GC (%): 60     Size: 20
Reverse primer Primer sequence:   CGTGTGCCTCCTCATTGACT     Tm(°C): 60.037     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 29     End: 309     Product size (bp): 281
JBrowse View      JBrowse