image


Statistics

Number of enzymes: 1
Total Number of designed primers: 10
Number of PGTM primers:     1
Number of PMTM primers:     9

Enzyme Id:  K12875
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101245055     NCBI Gene Symbol: LOC101245055
Gene Aliases
Gene description & Other designations Description:   putative DNA/RNA binding domain-containing protein      Other designations:   apoptotic chromatin condensation inducer in the nucleus
Chromosome, Strand & Exon count Chromosome:   4     Strand:   minus     Exon count:   7
Gene Location within genomic sequence Genomic accession No. NC_015441.3      Gene Start and end within genomic accession: 59715265 ...... 59723504
CDS Sequence 101245055
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GAT)3
Repeat start & end within CDS Repeat start: 178     Repeat end: 186
Forward primer Primer sequence:   GTCGGACTACCCTGTGCTTG     Tm(°C): 60.39     GC (%): 60     Size: 20
Reverse primer Primer sequence:   GGGGGATGCTCCAGAACATC     Tm(°C): 60.179     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 2     End: 274     Product size (bp): 273
JBrowse View      JBrowse

Enzyme Id:  K12875
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101245055     NCBI Gene Symbol: LOC101245055
Gene Aliases
Gene description & Other designations Description:   putative DNA/RNA binding domain-containing protein      Other designations:   apoptotic chromatin condensation inducer in the nucleus
Chromosome, Strand & Exon count Chromosome:   4     Strand:   minus     Exon count:   7
Gene Location within genomic sequence Genomic accession No. NC_015441.3      Gene Start and end within genomic accession: 59715265 ...... 59723504
CDS Sequence 101245055
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (CCA)3
Repeat start & end within CDS Repeat start: 428     Repeat end: 436
Forward primer Primer sequence:   ACCCGAGCCTGATCCTGTTA     Tm(°C): 60.325     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TTCTTGGTGCTAGCACTGGC     Tm(°C): 60.606     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 224     End: 568     Product size (bp): 345
JBrowse View      JBrowse

Enzyme Id:  K12875
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101245055     NCBI Gene Symbol: LOC101245055
Gene Aliases
Gene description & Other designations Description:   putative DNA/RNA binding domain-containing protein      Other designations:   apoptotic chromatin condensation inducer in the nucleus
Chromosome, Strand & Exon count Chromosome:   4     Strand:   minus     Exon count:   7
Gene Location within genomic sequence Genomic accession No. NC_015441.3      Gene Start and end within genomic accession: 59715265 ...... 59723504
CDS Sequence 101245055
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (ATG)3
Repeat start & end within CDS Repeat start: 497     Repeat end: 505
Forward primer Primer sequence:   AGTGATGTTGCTAGGGCCAC     Tm(°C): 60.035     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GGTCTGATTCTCCAGCAGCA     Tm(°C): 59.749     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 411     End: 645     Product size (bp): 235
JBrowse View      JBrowse

Enzyme Id:  K12875
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101245055     NCBI Gene Symbol: LOC101245055
Gene Aliases
Gene description & Other designations Description:   putative DNA/RNA binding domain-containing protein      Other designations:   apoptotic chromatin condensation inducer in the nucleus
Chromosome, Strand & Exon count Chromosome:   4     Strand:   minus     Exon count:   7
Gene Location within genomic sequence Genomic accession No. NC_015441.3      Gene Start and end within genomic accession: 59715265 ...... 59723504
CDS Sequence 101245055
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (CTG)3
Repeat start & end within CDS Repeat start: 626     Repeat end: 634
Forward primer Primer sequence:   AGTGATGTTGCTAGGGCCAC     Tm(°C): 60.035     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GTGCCTCCAAACGGTCTGAT     Tm(°C): 60.322     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 411     End: 657     Product size (bp): 247
JBrowse View      JBrowse

Enzyme Id:  K12875
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101245055     NCBI Gene Symbol: LOC101245055
Gene Aliases
Gene description & Other designations Description:   putative DNA/RNA binding domain-containing protein      Other designations:   apoptotic chromatin condensation inducer in the nucleus
Chromosome, Strand & Exon count Chromosome:   4     Strand:   minus     Exon count:   7
Gene Location within genomic sequence Genomic accession No. NC_015441.3      Gene Start and end within genomic accession: 59715265 ...... 59723504
CDS Sequence 101245055
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (TGA)3
Repeat start & end within CDS Repeat start: 1242     Repeat end: 1250
Forward primer Primer sequence:   GATGGAGCTGCAGTCATCCA     Tm(°C): 59.82     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TCTTCCGCAGATGCCTCAAT     Tm(°C): 59.457     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 1139     End: 1453     Product size (bp): 315
JBrowse View      JBrowse

Enzyme Id:  K12875
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101245055     NCBI Gene Symbol: LOC101245055
Gene Aliases
Gene description & Other designations Description:   putative DNA/RNA binding domain-containing protein      Other designations:   apoptotic chromatin condensation inducer in the nucleus
Chromosome, Strand & Exon count Chromosome:   4     Strand:   minus     Exon count:   7
Gene Location within genomic sequence Genomic accession No. NC_015441.3      Gene Start and end within genomic accession: 59715265 ...... 59723504
CDS Sequence 101245055
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GGA)3
Repeat start & end within CDS Repeat start: 1575     Repeat end: 1583
Forward primer Primer sequence:   GCCGATGTAGTGGATGGTGA     Tm(°C): 59.536     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GTGTTCCATCTACGCTGCCT     Tm(°C): 60.108     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1506     End: 1849     Product size (bp): 344
JBrowse View      JBrowse

Enzyme Id:  K12875
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101245055     NCBI Gene Symbol: LOC101245055
Gene Aliases
Gene description & Other designations Description:   putative DNA/RNA binding domain-containing protein      Other designations:   apoptotic chromatin condensation inducer in the nucleus
Chromosome, Strand & Exon count Chromosome:   4     Strand:   minus     Exon count:   7
Gene Location within genomic sequence Genomic accession No. NC_015441.3      Gene Start and end within genomic accession: 59715265 ...... 59723504
CDS Sequence 101245055
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (ATGCA)2
Repeat start & end within CDS Repeat start: 1703     Repeat end: 1712
Forward primer Primer sequence:   AGCCCAAAGTTCGACCAAGT     Tm(°C): 59.817     GC (%): 50     Size: 20
Reverse primer Primer sequence:   GTGTTCCATCTACGCTGCCT     Tm(°C): 60.108     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1672     End: 1849     Product size (bp): 178
JBrowse View      JBrowse

Enzyme Id:  K12875
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101245055     NCBI Gene Symbol: LOC101245055
Gene Aliases
Gene description & Other designations Description:   putative DNA/RNA binding domain-containing protein      Other designations:   apoptotic chromatin condensation inducer in the nucleus
Chromosome, Strand & Exon count Chromosome:   4     Strand:   minus     Exon count:   7
Gene Location within genomic sequence Genomic accession No. NC_015441.3      Gene Start and end within genomic accession: 59715265 ...... 59723504
CDS Sequence 101245055
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (AGAGA)2
Repeat start & end within CDS Repeat start: 1776     Repeat end: 1785
Forward primer Primer sequence:   AGCCCAAAGTTCGACCAAGT     Tm(°C): 59.817     GC (%): 50     Size: 20
Reverse primer Primer sequence:   GTGTTCCATCTACGCTGCCT     Tm(°C): 60.108     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1672     End: 1849     Product size (bp): 178
JBrowse View      JBrowse

Enzyme Id:  K12875
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101245055     NCBI Gene Symbol: LOC101245055
Gene Aliases
Gene description & Other designations Description:   putative DNA/RNA binding domain-containing protein      Other designations:   apoptotic chromatin condensation inducer in the nucleus
Chromosome, Strand & Exon count Chromosome:   4     Strand:   minus     Exon count:   7
Gene Location within genomic sequence Genomic accession No. NC_015441.3      Gene Start and end within genomic accession: 59715265 ...... 59723504
CDS Sequence 101245055
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (CAG)3
Repeat start & end within CDS Repeat start: 2338     Repeat end: 2346
Forward primer Primer sequence:   AGCCACAGAGACCAGAAACG     Tm(°C): 59.966     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ACTAGGAGGAGCAGGAGGTG     Tm(°C): 60.033     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 2150     End: 2411     Product size (bp): 262
JBrowse View      JBrowse

Enzyme Id:  K12875
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101245055     NCBI Gene Symbol: LOC101245055
Gene Aliases
Gene description & Other designations Description:   putative DNA/RNA binding domain-containing protein      Other designations:   apoptotic chromatin condensation inducer in the nucleus
Chromosome, Strand & Exon count Chromosome:   4     Strand:   minus     Exon count:   7
Gene Location within genomic sequence Genomic accession No. NC_015441.3      Gene Start and end within genomic accession: 59715265 ...... 59723504
CDS Sequence 101245055
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   AGCCACAGAGACCAGAAACG     Tm(°C): 59.966     GC (%): 55     Size: 20
Reverse primer Primer sequence:   ACTAGGAGGAGCAGGAGGTG     Tm(°C): 60.033     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 2150     End: 2411     Product size (bp): 262
JBrowse View      JBrowse