Statistics
Number of enzymes: 1
Total Number of designed primers: 3
Number of PGTM primers: 2
Number of PMTM primers: 1
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101250862 NCBI Gene Symbol: LOC101250862 |
| Gene Aliases | |
| Gene description & Other designations | Description: protein BUD31 homolog-like Other designations: protein BUD31 homolog 1|protein BUD31 homolog-like |
| Chromosome, Strand & Exon count | Chromosome: 11 Strand: minus Exon count: 4 |
| Gene Location within genomic sequence | Genomic accession No. NC_015448.3 Gene Start and end within genomic accession: 53073625 ...... 53078308 |
| CDS Sequence | 101250862 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (CGTGT)2 |
| Repeat start & end within CDS | Repeat start: 353 Repeat end: 362 |
| Forward primer | Primer sequence: AGGTTGCACATCAGAGGAGC Tm(°C): 60.036 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CAGCAGTTTCCCTGAGGTGT Tm(°C): 59.891 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 151 End: 387 Product size (bp): 237 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101250862 NCBI Gene Symbol: LOC101250862 |
| Gene Aliases | |
| Gene description & Other designations | Description: protein BUD31 homolog-like Other designations: protein BUD31 homolog 1|protein BUD31 homolog-like |
| Chromosome, Strand & Exon count | Chromosome: 11 Strand: minus Exon count: 4 |
| Gene Location within genomic sequence | Genomic accession No. NC_015448.3 Gene Start and end within genomic accession: 53073625 ...... 53078308 |
| CDS Sequence | 101250862 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: AGGTTGCACATCAGAGGAGC Tm(°C): 60.036 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: ACACGACACGCACAAGTAGT Tm(°C): 59.898 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 151 End: 361 Product size (bp): 211 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101264965 NCBI Gene Symbol: LOC101264965 |
| Gene Aliases | |
| Gene description & Other designations | Description: protein BUD31 homolog 2 Other designations: protein BUD31 homolog 2 |
| Chromosome, Strand & Exon count | Chromosome: 9 Strand: minus Exon count: 4 |
| Gene Location within genomic sequence | Genomic accession No. NC_015446.3 Gene Start and end within genomic accession: 2673488 ...... 2676773 |
| CDS Sequence | 101264965 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: GCTGTTTGAGGTGCATGCAA Tm(°C): 59.968 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: TACAGCCGCAATGGACACAT Tm(°C): 60.036 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 301 End: 414 Product size (bp): 114 |
| JBrowse View | JBrowse |
