Statistics
Number of enzymes: 1
Total Number of designed primers: 8
Number of PGTM primers: 1
Number of PMTM primers: 7
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101265451 NCBI Gene Symbol: LOC101265451 |
| Gene Aliases | |
| Gene description & Other designations | Description: protein STABILIZED1 Other designations: protein STABILIZED1 |
| Chromosome, Strand & Exon count | Chromosome: 7 Strand: plus Exon count: 1 |
| Gene Location within genomic sequence | Genomic accession No. NC_015444.3 Gene Start and end within genomic accession: 62685685 ...... 62689052 |
| CDS Sequence | 101265451 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Compound Repeat sequence: (AACCCT)2agaaattaatccttttgtaacttctcttca(AACCCT)2 |
| Repeat start & end within CDS | Repeat start: 30 Repeat end: 83 |
| Forward primer | Primer sequence: TGGTGTTCATCAATCTTCCGA Tm(°C): 57.306 GC (%): 42.857 Size: 21 |
| Reverse primer | Primer sequence: ACAGTGCTTCCACATCGAGG Tm(°C): 60.037 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 1 End: 168 Product size (bp): 168 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101265451 NCBI Gene Symbol: LOC101265451 |
| Gene Aliases | |
| Gene description & Other designations | Description: protein STABILIZED1 Other designations: protein STABILIZED1 |
| Chromosome, Strand & Exon count | Chromosome: 7 Strand: plus Exon count: 1 |
| Gene Location within genomic sequence | Genomic accession No. NC_015444.3 Gene Start and end within genomic accession: 62685685 ...... 62689052 |
| CDS Sequence | 101265451 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Hexa Repeat sequence: (ACTCTA)2 |
| Repeat start & end within CDS | Repeat start: 199 Repeat end: 210 |
| Forward primer | Primer sequence: CCTCGATGTGGAAGCACTGT Tm(°C): 60.037 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CACGAGCCGGACCAATATCA Tm(°C): 59.896 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 149 End: 360 Product size (bp): 212 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101265451 NCBI Gene Symbol: LOC101265451 |
| Gene Aliases | |
| Gene description & Other designations | Description: protein STABILIZED1 Other designations: protein STABILIZED1 |
| Chromosome, Strand & Exon count | Chromosome: 7 Strand: plus Exon count: 1 |
| Gene Location within genomic sequence | Genomic accession No. NC_015444.3 Gene Start and end within genomic accession: 62685685 ...... 62689052 |
| CDS Sequence | 101265451 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (TGGGT)2 |
| Repeat start & end within CDS | Repeat start: 303 Repeat end: 312 |
| Forward primer | Primer sequence: CCTCGATGTGGAAGCACTGT Tm(°C): 60.037 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CACGAGCCGGACCAATATCA Tm(°C): 59.896 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 149 End: 360 Product size (bp): 212 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101265451 NCBI Gene Symbol: LOC101265451 |
| Gene Aliases | |
| Gene description & Other designations | Description: protein STABILIZED1 Other designations: protein STABILIZED1 |
| Chromosome, Strand & Exon count | Chromosome: 7 Strand: plus Exon count: 1 |
| Gene Location within genomic sequence | Genomic accession No. NC_015444.3 Gene Start and end within genomic accession: 62685685 ...... 62689052 |
| CDS Sequence | 101265451 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Hexa Repeat sequence: (TGGACG)2 |
| Repeat start & end within CDS | Repeat start: 417 Repeat end: 428 |
| Forward primer | Primer sequence: CCTCGATGTGGAAGCACTGT Tm(°C): 60.037 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CTTTCTCCTCCGCATCCTCC Tm(°C): 59.894 GC (%): 60 Size: 20 |
| Primer start, end within sequence and product size | Start: 149 End: 477 Product size (bp): 329 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101265451 NCBI Gene Symbol: LOC101265451 |
| Gene Aliases | |
| Gene description & Other designations | Description: protein STABILIZED1 Other designations: protein STABILIZED1 |
| Chromosome, Strand & Exon count | Chromosome: 7 Strand: plus Exon count: 1 |
| Gene Location within genomic sequence | Genomic accession No. NC_015444.3 Gene Start and end within genomic accession: 62685685 ...... 62689052 |
| CDS Sequence | 101265451 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tri Repeat sequence: (AAG)3 |
| Repeat start & end within CDS | Repeat start: 778 Repeat end: 786 |
| Forward primer | Primer sequence: GATGTGGGGTTGTTTGCGTC Tm(°C): 60.04 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: ACGTGCTCTTTTTCCTGCCT Tm(°C): 60.179 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 519 End: 853 Product size (bp): 335 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101265451 NCBI Gene Symbol: LOC101265451 |
| Gene Aliases | |
| Gene description & Other designations | Description: protein STABILIZED1 Other designations: protein STABILIZED1 |
| Chromosome, Strand & Exon count | Chromosome: 7 Strand: plus Exon count: 1 |
| Gene Location within genomic sequence | Genomic accession No. NC_015444.3 Gene Start and end within genomic accession: 62685685 ...... 62689052 |
| CDS Sequence | 101265451 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Hexa Repeat sequence: (TGCTGA)2 |
| Repeat start & end within CDS | Repeat start: 1842 Repeat end: 1853 |
| Forward primer | Primer sequence: GGGCTTTGCAGAGAGAAGGT Tm(°C): 59.963 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TCAAGTGATTCCCTCGTGCC Tm(°C): 60.036 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 1684 End: 1990 Product size (bp): 307 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101265451 NCBI Gene Symbol: LOC101265451 |
| Gene Aliases | |
| Gene description & Other designations | Description: protein STABILIZED1 Other designations: protein STABILIZED1 |
| Chromosome, Strand & Exon count | Chromosome: 7 Strand: plus Exon count: 1 |
| Gene Location within genomic sequence | Genomic accession No. NC_015444.3 Gene Start and end within genomic accession: 62685685 ...... 62689052 |
| CDS Sequence | 101265451 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Compound Repeat sequence: (GA)4acttggaaatgtggat(GAGGA)2 |
| Repeat start & end within CDS | Repeat start: 2263 Repeat end: 2296 |
| Forward primer | Primer sequence: TTGGAGCGGGTTTGGATGAA Tm(°C): 59.889 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: AGAACTGCTCGAGCTTTGCT Tm(°C): 59.965 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 2229 End: 2506 Product size (bp): 278 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101265451 NCBI Gene Symbol: LOC101265451 |
| Gene Aliases | |
| Gene description & Other designations | Description: protein STABILIZED1 Other designations: protein STABILIZED1 |
| Chromosome, Strand & Exon count | Chromosome: 7 Strand: plus Exon count: 1 |
| Gene Location within genomic sequence | Genomic accession No. NC_015444.3 Gene Start and end within genomic accession: 62685685 ...... 62689052 |
| CDS Sequence | 101265451 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: AGCAAAGCTCGAGCAGTTCT Tm(°C): 59.965 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: CACATCGCTTCAGCACATCG Tm(°C): 59.974 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 2487 End: 2913 Product size (bp): 427 |
| JBrowse View | JBrowse |
