|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101252197 NCBI Gene Symbol: LOC101252197 |
| Gene Aliases | |
| Gene description & Other designations | Description: 110 kDa U5 small nuclear ribonucleoprotein component CLO Other designations: 110 kDa U5 small nuclear ribonucleoprotein component CLO |
| Chromosome, Strand & Exon count | Chromosome: 7 Strand: plus Exon count: 12 |
| Gene Location within genomic sequence | Genomic accession No. NC_015444.3 Gene Start and end within genomic accession: 1950568 ...... 1956946 |
| CDS Sequence | 101252197 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (AAAAT)2 |
| Repeat start & end within CDS | Repeat start: 2087 Repeat end: 2096 |
| Forward primer | Primer sequence: GTGGAAGTGAAGGTGGCTGA Tm(°C): 59.891 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: ATGCCCAAATAGACCGTGCA Tm(°C): 60.035 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 1992 End: 2244 Product size (bp): 253 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101252197 NCBI Gene Symbol: LOC101252197 |
| Gene Aliases | |
| Gene description & Other designations | Description: 110 kDa U5 small nuclear ribonucleoprotein component CLO Other designations: 110 kDa U5 small nuclear ribonucleoprotein component CLO |
| Chromosome, Strand & Exon count | Chromosome: 7 Strand: plus Exon count: 12 |
| Gene Location within genomic sequence | Genomic accession No. NC_015444.3 Gene Start and end within genomic accession: 1950568 ...... 1956946 |
| CDS Sequence | 101252197 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (CCAAA)2 |
| Repeat start & end within CDS | Repeat start: 2196 Repeat end: 2205 |
| Forward primer | Primer sequence: TTGTGAGCATCGATTGGCCT Tm(°C): 60.035 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: ATGCCCAAATAGACCGTGCA Tm(°C): 60.035 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 2152 End: 2244 Product size (bp): 93 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101252197 NCBI Gene Symbol: LOC101252197 |
| Gene Aliases | |
| Gene description & Other designations | Description: 110 kDa U5 small nuclear ribonucleoprotein component CLO Other designations: 110 kDa U5 small nuclear ribonucleoprotein component CLO |
| Chromosome, Strand & Exon count | Chromosome: 7 Strand: plus Exon count: 12 |
| Gene Location within genomic sequence | Genomic accession No. NC_015444.3 Gene Start and end within genomic accession: 1950568 ...... 1956946 |
| CDS Sequence | 101252197 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (AAGTG)2 |
| Repeat start & end within CDS | Repeat start: 2295 Repeat end: 2304 |
| Forward primer | Primer sequence: TGCACGGTCTATTTGGGCAT Tm(°C): 60.035 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: TCATCGCAAAGGGGTCCTTC Tm(°C): 60.035 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 2225 End: 2386 Product size (bp): 162 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101252197 NCBI Gene Symbol: LOC101252197 |
| Gene Aliases | |
| Gene description & Other designations | Description: 110 kDa U5 small nuclear ribonucleoprotein component CLO Other designations: 110 kDa U5 small nuclear ribonucleoprotein component CLO |
| Chromosome, Strand & Exon count | Chromosome: 7 Strand: plus Exon count: 12 |
| Gene Location within genomic sequence | Genomic accession No. NC_015444.3 Gene Start and end within genomic accession: 1950568 ...... 1956946 |
| CDS Sequence | 101252197 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (TCCAA)2 |
| Repeat start & end within CDS | Repeat start: 2814 Repeat end: 2823 |
| Forward primer | Primer sequence: CCAAACGCCCATGGATTGTC Tm(°C): 59.827 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: ACCATGAACTCACGAGCCAG Tm(°C): 60.037 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 2549 End: 2845 Product size (bp): 297 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101252197 NCBI Gene Symbol: LOC101252197 |
| Gene Aliases | |
| Gene description & Other designations | Description: 110 kDa U5 small nuclear ribonucleoprotein component CLO Other designations: 110 kDa U5 small nuclear ribonucleoprotein component CLO |
| Chromosome, Strand & Exon count | Chromosome: 7 Strand: plus Exon count: 12 |
| Gene Location within genomic sequence | Genomic accession No. NC_015444.3 Gene Start and end within genomic accession: 1950568 ...... 1956946 |
| CDS Sequence | 101252197 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Compound Repeat sequence: (GGAAGA)2cgatgagctgcctgataggag(TGA)3gagagctgtatc(TGA)3 |
| Repeat start & end within CDS | Repeat start: 75 Repeat end: 137 |
| Forward primer | Primer sequence: None Tm(°C): GC (%): Size: |
| Reverse primer | Primer sequence: None Tm(°C): GC (%): Size: |
| Primer start, end within sequence and product size | Start: End: Product size (bp): |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101252197 NCBI Gene Symbol: LOC101252197 |
| Gene Aliases | |
| Gene description & Other designations | Description: 110 kDa U5 small nuclear ribonucleoprotein component CLO Other designations: 110 kDa U5 small nuclear ribonucleoprotein component CLO |
| Chromosome, Strand & Exon count | Chromosome: 7 Strand: plus Exon count: 12 |
| Gene Location within genomic sequence | Genomic accession No. NC_015444.3 Gene Start and end within genomic accession: 1950568 ...... 1956946 |
| CDS Sequence | 101252197 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: CCAGGTGCATGGGTTCTGAT Tm(°C): 60.034 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: AGGCCAATCGATGCTCACAA Tm(°C): 60.035 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 1677 End: 2171 Product size (bp): 495 |
| JBrowse View | JBrowse |
