|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101244419 NCBI Gene Symbol: LOC101244419 |
| Gene Aliases | |
| Gene description & Other designations | Description: zinc finger matrin-type protein 2 Other designations: zinc finger matrin-type protein 2 |
| Chromosome, Strand & Exon count | Chromosome: 1 Strand: plus Exon count: 10 |
| Gene Location within genomic sequence | Genomic accession No. NC_015438.3 Gene Start and end within genomic accession: 90272291 ...... 90278544 |
| CDS Sequence | 101244419 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Compound Repeat sequence: (CAG)3(AGGAAG)2*aaaggaaacgtttacgtcgagaaaagaagaaag(AGA)3 |
| Repeat start & end within CDS | Repeat start: 460 Repeat end: 520 |
| Forward primer | Primer sequence: TGTCTATGCGGGTGGAGAGA Tm(°C): 60.034 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TCCGAATCCCATCATAGCTGC Tm(°C): 59.998 GC (%): 52.381 Size: 21 |
| Primer start, end within sequence and product size | Start: 340 End: 584 Product size (bp): 245 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101244419 NCBI Gene Symbol: LOC101244419 |
| Gene Aliases | |
| Gene description & Other designations | Description: zinc finger matrin-type protein 2 Other designations: zinc finger matrin-type protein 2 |
| Chromosome, Strand & Exon count | Chromosome: 1 Strand: plus Exon count: 10 |
| Gene Location within genomic sequence | Genomic accession No. NC_015438.3 Gene Start and end within genomic accession: 90272291 ...... 90278544 |
| CDS Sequence | 101244419 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: GAAGAGGAGGCTGATGGTCG Tm(°C): 59.896 GC (%): 60 Size: 20 |
| Reverse primer | Primer sequence: TCTCTCCACCCGCATAGACA Tm(°C): 60.034 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 96 End: 359 Product size (bp): 264 |
| JBrowse View | JBrowse |
