image


Statistics

Number of enzymes: 1
Total Number of designed primers: 3
Number of PGTM primers:     1
Number of PMTM primers:     2

Enzyme Id:  K12847
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101263781     NCBI Gene Symbol: LOC101263781
Gene Aliases
Gene description & Other designations Description:   U4/U6.U5 tri-snRNP-associated protein 2      Other designations:   U4/U6.U5 tri-snRNP-associated protein 2
Chromosome, Strand & Exon count Chromosome:   2     Strand:   minus     Exon count:   10
Gene Location within genomic sequence Genomic accession No. NC_015439.3      Gene Start and end within genomic accession: 38984587 ...... 38992012
CDS Sequence 101263781
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (ATG)4
Repeat start & end within CDS Repeat start: 137     Repeat end: 148
Forward primer Primer sequence:   AGTAGAAGATGGCGTGGTGC     Tm(°C): 60.108     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TTTCGCTTCCCTTGGCTTCT     Tm(°C): 59.89     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 17     End: 283     Product size (bp): 267
JBrowse View      JBrowse

Enzyme Id:  K12847
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101263781     NCBI Gene Symbol: LOC101263781
Gene Aliases
Gene description & Other designations Description:   U4/U6.U5 tri-snRNP-associated protein 2      Other designations:   U4/U6.U5 tri-snRNP-associated protein 2
Chromosome, Strand & Exon count Chromosome:   2     Strand:   minus     Exon count:   10
Gene Location within genomic sequence Genomic accession No. NC_015439.3      Gene Start and end within genomic accession: 38984587 ...... 38992012
CDS Sequence 101263781
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (TGATT)2
Repeat start & end within CDS Repeat start: 1473     Repeat end: 1482
Forward primer Primer sequence:   CTGAAGTTGTAAGGCCCCGT     Tm(°C): 59.964     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TTCGCCTGGCTTTCCATCAT     Tm(°C): 60.034     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 1261     End: 1514     Product size (bp): 254
JBrowse View      JBrowse

Enzyme Id:  K12847
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101263781     NCBI Gene Symbol: LOC101263781
Gene Aliases
Gene description & Other designations Description:   U4/U6.U5 tri-snRNP-associated protein 2      Other designations:   U4/U6.U5 tri-snRNP-associated protein 2
Chromosome, Strand & Exon count Chromosome:   2     Strand:   minus     Exon count:   10
Gene Location within genomic sequence Genomic accession No. NC_015439.3      Gene Start and end within genomic accession: 38984587 ...... 38992012
CDS Sequence 101263781
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   CTGAAGTTGTAAGGCCCCGT     Tm(°C): 59.964     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TTCGCCTGGCTTTCCATCAT     Tm(°C): 60.034     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 1261     End: 1514     Product size (bp): 254
JBrowse View      JBrowse