Enzyme Id: K12845 |
||||||||||||||||||||||||||||||||||||||||||||||||
| Gene Information | ||||||||||||||||||||||||||||||||||||||||||||||||
| NCBI Gene Accession Number & Symbol | Accession Number: 101244799 NCBI Gene Symbol: LOC101244799 | |||||||||||||||||||||||||||||||||||||||||||||||
| Gene Aliases | ||||||||||||||||||||||||||||||||||||||||||||||||
| Gene description & Other designations | Description: NHP2-like protein 1 Other designations: NHP2-like protein 1 | |||||||||||||||||||||||||||||||||||||||||||||||
| Chromosome, Strand & Exon count | Chromosome: 9 Strand: plus Exon count: 5 | |||||||||||||||||||||||||||||||||||||||||||||||
| Gene Location within genomic sequence | Genomic accession No. NC_015446.3 Gene Start and end within genomic accession: 4751710 ...... 4754499 | |||||||||||||||||||||||||||||||||||||||||||||||
| CDS Sequence | 101244799 | |||||||||||||||||||||||||||||||||||||||||||||||
| Marker Information | ||||||||||||||||||||||||||||||||||||||||||||||||
| Marker Type | PGTM | |||||||||||||||||||||||||||||||||||||||||||||||
| Repeat type & sequence | Repeat type: Repeat sequence: | |||||||||||||||||||||||||||||||||||||||||||||||
| Repeat start & end within CDS | Repeat start: Repeat end: | |||||||||||||||||||||||||||||||||||||||||||||||
| Forward primer | Primer sequence: GCAACGGAAACTGTGAACCC Tm(°C): 59.97 GC (%): 55 Size: 20 | |||||||||||||||||||||||||||||||||||||||||||||||
| Reverse primer | Primer sequence: TCAGTATCTGCGGCCATGAC Tm(°C): 59.895 GC (%): 55 Size: 20 | |||||||||||||||||||||||||||||||||||||||||||||||
| Primer start, end within sequence and product size | Start: 3 End: 181 Product size (bp): 179 | |||||||||||||||||||||||||||||||||||||||||||||||
| JBrowse View | JBrowse | |||||||||||||||||||||||||||||||||||||||||||||||
Enzyme Id: K12845 |
||
| Gene Information | ||
| NCBI Gene Accession Number & Symbol | Accession Number: 101267649 NCBI Gene Symbol: LOC101267649 | |
| Gene Aliases | ||
| Gene description & Other designations | Description: NHP2-like protein 1 Other designations: NHP2-like protein 1 | |
| Chromosome, Strand & Exon count | Chromosome: 9 Strand: plus Exon count: 5 | |
| Gene Location within genomic sequence | Genomic accession No. NC_015446.3 Gene Start and end within genomic accession: 71708153 ...... 71710773 | |
| CDS Sequence | 101267649 | |
| Marker Information | ||
| Marker Type | PGTM | |
| Repeat type & sequence | Repeat type: Repeat sequence: | |
| Repeat start & end within CDS | Repeat start: Repeat end: | |
| Forward primer | Primer sequence: TCGTTGTCATGGCTGCAGAT Tm(°C): 60.036 GC (%): 50 Size: 20 | |
| Reverse primer | Primer sequence: ACTGGCTTCCCTCATTGCTC Tm(°C): 60.035 GC (%): 55 Size: 20 | |
| Primer start, end within sequence and product size | Start: 157 End: 333 Product size (bp): 177 | |
| JBrowse View | JBrowse | |