Statistics
Number of enzymes: 1
Total Number of designed primers: 4
Number of PGTM primers: 2
Number of PMTM primers: 2
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101243803 NCBI Gene Symbol: LOC101243803 |
| Gene Aliases | |
| Gene description & Other designations | Description: U4/U6 small nuclear ribonucleoprotein Prp31 homolog Other designations: U4/U6 small nuclear ribonucleoprotein Prp31 homolog |
| Chromosome, Strand & Exon count | Chromosome: 7 Strand: plus Exon count: 3 |
| Gene Location within genomic sequence | Genomic accession No. NC_015444.3 Gene Start and end within genomic accession: 66490355 ...... 66492429 |
| CDS Sequence | 101243803 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tri Repeat sequence: (GAA)3 |
| Repeat start & end within CDS | Repeat start: 144 Repeat end: 152 |
| Forward primer | Primer sequence: GGCGTCAACTACTAGTGGCA Tm(°C): 59.754 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: ACCACCCAGACTCCTCACAT Tm(°C): 60.179 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 53 End: 305 Product size (bp): 253 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101243803 NCBI Gene Symbol: LOC101243803 |
| Gene Aliases | |
| Gene description & Other designations | Description: U4/U6 small nuclear ribonucleoprotein Prp31 homolog Other designations: U4/U6 small nuclear ribonucleoprotein Prp31 homolog |
| Chromosome, Strand & Exon count | Chromosome: 7 Strand: plus Exon count: 3 |
| Gene Location within genomic sequence | Genomic accession No. NC_015444.3 Gene Start and end within genomic accession: 66490355 ...... 66492429 |
| CDS Sequence | 101243803 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: AAGCAGAGAGGTGGTGTTCG Tm(°C): 59.966 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CAGCCTGACCAAGCATACCA Tm(°C): 60.035 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 579 End: 732 Product size (bp): 154 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101261054 NCBI Gene Symbol: LOC101261054 |
| Gene Aliases | |
| Gene description & Other designations | Description: U4/U6 small nuclear ribonucleoprotein Prp31 Other designations: U4/U6 small nuclear ribonucleoprotein Prp31 |
| Chromosome, Strand & Exon count | Chromosome: 8 Strand: minus Exon count: 8 |
| Gene Location within genomic sequence | Genomic accession No. NC_015445.3 Gene Start and end within genomic accession: 62360782 ...... 62364892 |
| CDS Sequence | 101261054 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (GAAAT)2 |
| Repeat start & end within CDS | Repeat start: 434 Repeat end: 443 |
| Forward primer | Primer sequence: ACCCGATTGATTATGCCCGT Tm(°C): 59.528 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: TGCACTCCCAACTACAGCAG Tm(°C): 59.965 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 397 End: 677 Product size (bp): 281 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101261054 NCBI Gene Symbol: LOC101261054 |
| Gene Aliases | |
| Gene description & Other designations | Description: U4/U6 small nuclear ribonucleoprotein Prp31 Other designations: U4/U6 small nuclear ribonucleoprotein Prp31 |
| Chromosome, Strand & Exon count | Chromosome: 8 Strand: minus Exon count: 8 |
| Gene Location within genomic sequence | Genomic accession No. NC_015445.3 Gene Start and end within genomic accession: 62360782 ...... 62364892 |
| CDS Sequence | 101261054 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: TGCTGTAGTTGGGAGTGCAG Tm(°C): 59.965 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TGATCGAGTCAACACGTGCA Tm(°C): 59.969 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 659 End: 924 Product size (bp): 266 |
| JBrowse View | JBrowse |
