|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101261199 NCBI Gene Symbol: LOC101261199 |
| Gene Aliases | |
| Gene description & Other designations | Description: protein RRC1-like Other designations: LOW QUALITY PROTEIN: protein RRC1-like |
| Chromosome, Strand & Exon count | Chromosome: 3 Strand: plus Exon count: 16 |
| Gene Location within genomic sequence | Genomic accession No. NC_015440.3 Gene Start and end within genomic accession: 2741061 ...... 2759315 |
| CDS Sequence | 101261199 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Compound Repeat sequence: (CTC)3caggacatatggctatcaggagtaaggagggtgcaactg(TTATC)2 |
| Repeat start & end within CDS | Repeat start: 815 Repeat end: 872 |
| Forward primer | Primer sequence: TCTGCCTTCTCAAGCACTCC Tm(°C): 59.677 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CAACCTCCGTCGAGAACACA Tm(°C): 59.968 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 791 End: 1027 Product size (bp): 237 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101261199 NCBI Gene Symbol: LOC101261199 |
| Gene Aliases | |
| Gene description & Other designations | Description: protein RRC1-like Other designations: LOW QUALITY PROTEIN: protein RRC1-like |
| Chromosome, Strand & Exon count | Chromosome: 3 Strand: plus Exon count: 16 |
| Gene Location within genomic sequence | Genomic accession No. NC_015440.3 Gene Start and end within genomic accession: 2741061 ...... 2759315 |
| CDS Sequence | 101261199 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Compound Repeat sequence: (ACTTG)2(ACTTGC)2* |
| Repeat start & end within CDS | Repeat start: 1673 Repeat end: 1689 |
| Forward primer | Primer sequence: TGCATCTGCTTATCGCACCA Tm(°C): 60.108 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: GAATGGAAGGGGGTCACACC Tm(°C): 60.323 GC (%): 60 Size: 20 |
| Primer start, end within sequence and product size | Start: 1544 End: 1876 Product size (bp): 333 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101261199 NCBI Gene Symbol: LOC101261199 |
| Gene Aliases | |
| Gene description & Other designations | Description: protein RRC1-like Other designations: LOW QUALITY PROTEIN: protein RRC1-like |
| Chromosome, Strand & Exon count | Chromosome: 3 Strand: plus Exon count: 16 |
| Gene Location within genomic sequence | Genomic accession No. NC_015440.3 Gene Start and end within genomic accession: 2741061 ...... 2759315 |
| CDS Sequence | 101261199 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tri Repeat sequence: (TGA)3 |
| Repeat start & end within CDS | Repeat start: 2394 Repeat end: 2402 |
| Forward primer | Primer sequence: TGGGCCAGAGAGGATGATGA Tm(°C): 60.031 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: AGCCCATCACCAGCATTCTC Tm(°C): 60.107 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 2370 End: 2473 Product size (bp): 104 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101261199 NCBI Gene Symbol: LOC101261199 |
| Gene Aliases | |
| Gene description & Other designations | Description: protein RRC1-like Other designations: LOW QUALITY PROTEIN: protein RRC1-like |
| Chromosome, Strand & Exon count | Chromosome: 3 Strand: plus Exon count: 16 |
| Gene Location within genomic sequence | Genomic accession No. NC_015440.3 Gene Start and end within genomic accession: 2741061 ...... 2759315 |
| CDS Sequence | 101261199 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Di Repeat sequence: (GA)4 |
| Repeat start & end within CDS | Repeat start: 2896 Repeat end: 2903 |
| Forward primer | Primer sequence: GCAGGTCATCTTCGGAGAGG Tm(°C): 59.896 GC (%): 60 Size: 20 |
| Reverse primer | Primer sequence: CATCTGGCCCGTCTCCTTTC Tm(°C): 60.463 GC (%): 60 Size: 20 |
| Primer start, end within sequence and product size | Start: 2725 End: 2947 Product size (bp): 223 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101261199 NCBI Gene Symbol: LOC101261199 |
| Gene Aliases | |
| Gene description & Other designations | Description: protein RRC1-like Other designations: LOW QUALITY PROTEIN: protein RRC1-like |
| Chromosome, Strand & Exon count | Chromosome: 3 Strand: plus Exon count: 16 |
| Gene Location within genomic sequence | Genomic accession No. NC_015440.3 Gene Start and end within genomic accession: 2741061 ...... 2759315 |
| CDS Sequence | 101261199 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: AGAAAGACGATGCAGGCACA Tm(°C): 59.965 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: TCATCATCCTCTCTGGCCCA Tm(°C): 60.031 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 2021 End: 2389 Product size (bp): 369 |
| JBrowse View | JBrowse |
