|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101263271 NCBI Gene Symbol: LOC101263271 |
| Gene Aliases | |
| Gene description & Other designations | Description: DNA-damage-repair/toleration protein DRT111; chloroplastic Other designations: DNA-damage-repair/toleration protein DRT111; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: 2 Strand: plus Exon count: 2 |
| Gene Location within genomic sequence | Genomic accession No. NC_015439.3 Gene Start and end within genomic accession: 40187812 ...... 40191907 |
| CDS Sequence | 101263271 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Compound Repeat sequence: (AGA)3ggaagcaaatggaggctgaggtgcggagagagttggaagaa(AG)4aaa
ggagagggagcgagagagggaggaaaaggagaagagagaaaa(AG)4 |
| Repeat start & end within CDS | Repeat start: 353 Repeat end: 463 |
| Forward primer | Primer sequence: GCCTTCAGCAGCTCCAAAAC Tm(°C): 60.039 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CCATGCCTCCTCACCTGAAA Tm(°C): 59.671 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 182 End: 491 Product size (bp): 310 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101263271 NCBI Gene Symbol: LOC101263271 |
| Gene Aliases | |
| Gene description & Other designations | Description: DNA-damage-repair/toleration protein DRT111; chloroplastic Other designations: DNA-damage-repair/toleration protein DRT111; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: 2 Strand: plus Exon count: 2 |
| Gene Location within genomic sequence | Genomic accession No. NC_015439.3 Gene Start and end within genomic accession: 40187812 ...... 40191907 |
| CDS Sequence | 101263271 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Tri Repeat sequence: (GGA)3 |
| Repeat start & end within CDS | Repeat start: 523 Repeat end: 531 |
| Forward primer | Primer sequence: AAGGAGAGGGAGCGAGAGAG Tm(°C): 60.107 GC (%): 60 Size: 20 |
| Reverse primer | Primer sequence: ATTCCCTGCTCCAGCTTTCC Tm(°C): 60.034 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 411 End: 706 Product size (bp): 296 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101263271 NCBI Gene Symbol: LOC101263271 |
| Gene Aliases | |
| Gene description & Other designations | Description: DNA-damage-repair/toleration protein DRT111; chloroplastic Other designations: DNA-damage-repair/toleration protein DRT111; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: 2 Strand: plus Exon count: 2 |
| Gene Location within genomic sequence | Genomic accession No. NC_015439.3 Gene Start and end within genomic accession: 40187812 ...... 40191907 |
| CDS Sequence | 101263271 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Hexa Repeat sequence: (TTGGGA)2 |
| Repeat start & end within CDS | Repeat start: 607 Repeat end: 618 |
| Forward primer | Primer sequence: AAGGAGAGGGAGCGAGAGAG Tm(°C): 60.107 GC (%): 60 Size: 20 |
| Reverse primer | Primer sequence: ATTCCCTGCTCCAGCTTTCC Tm(°C): 60.034 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 411 End: 706 Product size (bp): 296 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101263271 NCBI Gene Symbol: LOC101263271 |
| Gene Aliases | |
| Gene description & Other designations | Description: DNA-damage-repair/toleration protein DRT111; chloroplastic Other designations: DNA-damage-repair/toleration protein DRT111; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: 2 Strand: plus Exon count: 2 |
| Gene Location within genomic sequence | Genomic accession No. NC_015439.3 Gene Start and end within genomic accession: 40187812 ...... 40191907 |
| CDS Sequence | 101263271 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Compound Repeat sequence: (AAGCA)2(AGC)4*aa(CAG)3(CAA)6 |
| Repeat start & end within CDS | Repeat start: 767 Repeat end: 813 |
| Forward primer | Primer sequence: GGAAAGCTGGAGCAGGGAAT Tm(°C): 60.034 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: ATTCCTAAGCAGCACGACCC Tm(°C): 60.108 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 687 End: 884 Product size (bp): 198 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101263271 NCBI Gene Symbol: LOC101263271 |
| Gene Aliases | |
| Gene description & Other designations | Description: DNA-damage-repair/toleration protein DRT111; chloroplastic Other designations: DNA-damage-repair/toleration protein DRT111; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: 2 Strand: plus Exon count: 2 |
| Gene Location within genomic sequence | Genomic accession No. NC_015439.3 Gene Start and end within genomic accession: 40187812 ...... 40191907 |
| CDS Sequence | 101263271 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Compound Repeat sequence: (TGA)3cctaga(AGGTG)2 |
| Repeat start & end within CDS | Repeat start: 906 Repeat end: 930 |
| Forward primer | Primer sequence: GGGTCGTGCTGCTTAGGAAT Tm(°C): 60.108 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TTGCCAAACCTCTCCTCGTC Tm(°C): 59.965 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 865 End: 1138 Product size (bp): 274 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101263271 NCBI Gene Symbol: LOC101263271 |
| Gene Aliases | |
| Gene description & Other designations | Description: DNA-damage-repair/toleration protein DRT111; chloroplastic Other designations: DNA-damage-repair/toleration protein DRT111; chloroplastic |
| Chromosome, Strand & Exon count | Chromosome: 2 Strand: plus Exon count: 2 |
| Gene Location within genomic sequence | Genomic accession No. NC_015439.3 Gene Start and end within genomic accession: 40187812 ...... 40191907 |
| CDS Sequence | 101263271 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: GGAAAGCTGGAGCAGGGAAT Tm(°C): 60.034 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TTGCCAAACCTCTCCTCGTC Tm(°C): 59.965 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 687 End: 1138 Product size (bp): 452 |
| JBrowse View | JBrowse |
