Statistics
Number of enzymes: 1
Total Number of designed primers: 3
Number of PGTM primers: 1
Number of PMTM primers: 2
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101256129 NCBI Gene Symbol: LOC101256129 |
| Gene Aliases | |
| Gene description & Other designations | Description: tudor domain-containing protein Other designations: tudor domain-containing protein |
| Chromosome, Strand & Exon count | Chromosome: 1 Strand: plus Exon count: 8 |
| Gene Location within genomic sequence | Genomic accession No. NC_015438.3 Gene Start and end within genomic accession: 91566188 ...... 91572149 |
| CDS Sequence | 101256129 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (GATGG)2 |
| Repeat start & end within CDS | Repeat start: 193 Repeat end: 202 |
| Forward primer | Primer sequence: GAACAACTTCAGCAGGTGCG Tm(°C): 60.041 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TGTGCGCGTGAATAGTAGCA Tm(°C): 60.109 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 60 End: 369 Product size (bp): 310 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101256129 NCBI Gene Symbol: LOC101256129 |
| Gene Aliases | |
| Gene description & Other designations | Description: tudor domain-containing protein Other designations: tudor domain-containing protein |
| Chromosome, Strand & Exon count | Chromosome: 1 Strand: plus Exon count: 8 |
| Gene Location within genomic sequence | Genomic accession No. NC_015438.3 Gene Start and end within genomic accession: 91566188 ...... 91572149 |
| CDS Sequence | 101256129 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Hexa Repeat sequence: (AAAAAG)2 |
| Repeat start & end within CDS | Repeat start: 616 Repeat end: 627 |
| Forward primer | Primer sequence: TCGAAGTTTGCCAGCAAAGC Tm(°C): 59.969 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: CCGAAGCCTCAGAATTTGCG Tm(°C): 59.902 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 554 End: 891 Product size (bp): 338 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101256129 NCBI Gene Symbol: LOC101256129 |
| Gene Aliases | |
| Gene description & Other designations | Description: tudor domain-containing protein Other designations: tudor domain-containing protein |
| Chromosome, Strand & Exon count | Chromosome: 1 Strand: plus Exon count: 8 |
| Gene Location within genomic sequence | Genomic accession No. NC_015438.3 Gene Start and end within genomic accession: 91566188 ...... 91572149 |
| CDS Sequence | 101256129 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: TCGAAGTTTGCCAGCAAAGC Tm(°C): 59.969 GC (%): 50 Size: 20 |
| Reverse primer | Primer sequence: CCGAAGCCTCAGAATTTGCG Tm(°C): 59.902 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 554 End: 891 Product size (bp): 338 |
| JBrowse View | JBrowse |
