Download Search Result

Enzyme Id:  K12827
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number:   101254575     NCBI Gene Symbol: LOC101254575
Gene Aliases
Gene description & Other designations	Description:   splicing factor SF3a60 homolog      Other designations:   splicing factor SF3a60 homolog|splicing factor 3A subunit 3
Chromosome, Strand & Exon count	Chromosome:   3     Strand:   minus     Exon count:   14
Gene Location within genomic sequence	Genomic accession No. NC_015440.3      Gene Start and end within genomic accession: 54725200 ...... 54733681
CDS Sequence	101254575
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Compound     Repeat sequence: (CA)4aactagtag(AT)4
Repeat start & end within CDS	Repeat start: 162     Repeat end: 186
Forward primer	Primer sequence:   AGGAAGTTGAGCGGTTCGAG     Tm(°C): 60.038     GC (%): 55     Size: 20
Reverse primer	Primer sequence:   CCTCGCTCCGTCTTTGTCTT     Tm(°C): 60.038     GC (%): 55     Size: 20
Primer start, end within sequence and product size	Start: 40     End: 206     Product size (bp): 167
JBrowse View	JBrowse

Enzyme Id:  K12827
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number:   101254575     NCBI Gene Symbol: LOC101254575
Gene Aliases
Gene description & Other designations	Description:   splicing factor SF3a60 homolog      Other designations:   splicing factor SF3a60 homolog|splicing factor 3A subunit 3
Chromosome, Strand & Exon count	Chromosome:   3     Strand:   minus     Exon count:   14
Gene Location within genomic sequence	Genomic accession No. NC_015440.3      Gene Start and end within genomic accession: 54725200 ...... 54733681
CDS Sequence	101254575
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Compound     Repeat sequence: (TGA)3agaccaacaaatttataatcctctgaaattgccaatgggc(TGGGA)2
Repeat start & end within CDS	Repeat start: 1134     Repeat end: 1192
Forward primer	Primer sequence:   GCAGAACGTGAAGAGGACGA     Tm(°C): 60.039     GC (%): 55     Size: 20
Reverse primer	Primer sequence:   ATGCCGCTCATAAGCCCTAC     Tm(°C): 59.965     GC (%): 55     Size: 20
Primer start, end within sequence and product size	Start: 1092     End: 1298     Product size (bp): 207
JBrowse View	JBrowse

Enzyme Id:  K12827
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number:   101254575     NCBI Gene Symbol: LOC101254575
Gene Aliases
Gene description & Other designations	Description:   splicing factor SF3a60 homolog      Other designations:   splicing factor SF3a60 homolog|splicing factor 3A subunit 3
Chromosome, Strand & Exon count	Chromosome:   3     Strand:   minus     Exon count:   14
Gene Location within genomic sequence	Genomic accession No. NC_015440.3      Gene Start and end within genomic accession: 54725200 ...... 54733681
CDS Sequence	101254575
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Tri     Repeat sequence: (GAA)3
Repeat start & end within CDS	Repeat start: 1450     Repeat end: 1458
Forward primer	Primer sequence:   TAAGTGGCGCCCTGATCTTG     Tm(°C): 60.108     GC (%): 55     Size: 20
Reverse primer	Primer sequence:   CCCTGGCGTTGAAGATCAGT     Tm(°C): 60.036     GC (%): 55     Size: 20
Primer start, end within sequence and product size	Start: 1430     End: 1519     Product size (bp): 90
JBrowse View	JBrowse

Enzyme Id:  K12827
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number:   101254575     NCBI Gene Symbol: LOC101254575
Gene Aliases
Gene description & Other designations	Description:   splicing factor SF3a60 homolog      Other designations:   splicing factor SF3a60 homolog|splicing factor 3A subunit 3
Chromosome, Strand & Exon count	Chromosome:   3     Strand:   minus     Exon count:   14
Gene Location within genomic sequence	Genomic accession No. NC_015440.3      Gene Start and end within genomic accession: 54725200 ...... 54733681
CDS Sequence	101254575
	Marker Information
Marker Type	PGTM
Repeat type & sequence	Repeat type:      Repeat sequence:
Repeat start & end within CDS	Repeat start:      Repeat end:
Forward primer	Primer sequence:   GGAGCACTGGGACTGAAGAC     Tm(°C): 60.037     GC (%): 60     Size: 20
Reverse primer	Primer sequence:   ATGCCGCTCATAAGCCCTAC     Tm(°C): 59.965     GC (%): 55     Size: 20
Primer start, end within sequence and product size	Start: 807     End: 1298     Product size (bp): 492
JBrowse View	JBrowse