|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101250296 NCBI Gene Symbol: LOC101250296 |
| Gene Aliases | |
| Gene description & Other designations | Description: pre-mRNA-processing protein 40C Other designations: pre-mRNA-processing protein 40C |
| Chromosome, Strand & Exon count | Chromosome: 4 Strand: plus Exon count: 20 |
| Gene Location within genomic sequence | Genomic accession No. NC_015441.3 Gene Start and end within genomic accession: 2355972 ...... 2378893 |
| CDS Sequence | 101250296 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Hexa Repeat sequence: (TGATGC)2 |
| Repeat start & end within CDS | Repeat start: 1566 Repeat end: 1577 |
| Forward primer | Primer sequence: AGAGCCTGGCAAAGTAGCTG Tm(°C): 60.036 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GCATCACGACCACCAGTACT Tm(°C): 59.753 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 1394 End: 1684 Product size (bp): 291 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101250296 NCBI Gene Symbol: LOC101250296 |
| Gene Aliases | |
| Gene description & Other designations | Description: pre-mRNA-processing protein 40C Other designations: pre-mRNA-processing protein 40C |
| Chromosome, Strand & Exon count | Chromosome: 4 Strand: plus Exon count: 20 |
| Gene Location within genomic sequence | Genomic accession No. NC_015441.3 Gene Start and end within genomic accession: 2355972 ...... 2378893 |
| CDS Sequence | 101250296 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Hexa Repeat sequence: (CCAGCC)2 |
| Repeat start & end within CDS | Repeat start: 1783 Repeat end: 1794 |
| Forward primer | Primer sequence: AGTACTGGTGGTCGTGATGC Tm(°C): 59.753 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GGTGCTACTCCACGTTCCTT Tm(°C): 59.679 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 1665 End: 2014 Product size (bp): 350 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101250296 NCBI Gene Symbol: LOC101250296 |
| Gene Aliases | |
| Gene description & Other designations | Description: pre-mRNA-processing protein 40C Other designations: pre-mRNA-processing protein 40C |
| Chromosome, Strand & Exon count | Chromosome: 4 Strand: plus Exon count: 20 |
| Gene Location within genomic sequence | Genomic accession No. NC_015441.3 Gene Start and end within genomic accession: 2355972 ...... 2378893 |
| CDS Sequence | 101250296 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Hexa Repeat sequence: (TTCAGA)2 |
| Repeat start & end within CDS | Repeat start: 1926 Repeat end: 1937 |
| Forward primer | Primer sequence: TGTTTCTTCACCAGCCCCAG Tm(°C): 60.179 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: ATGGTGCTACTCCACGTTCC Tm(°C): 59.751 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 1772 End: 2016 Product size (bp): 245 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101250296 NCBI Gene Symbol: LOC101250296 |
| Gene Aliases | |
| Gene description & Other designations | Description: pre-mRNA-processing protein 40C Other designations: pre-mRNA-processing protein 40C |
| Chromosome, Strand & Exon count | Chromosome: 4 Strand: plus Exon count: 20 |
| Gene Location within genomic sequence | Genomic accession No. NC_015441.3 Gene Start and end within genomic accession: 2355972 ...... 2378893 |
| CDS Sequence | 101250296 |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Hexa Repeat sequence: (GCAAAA)2 |
| Repeat start & end within CDS | Repeat start: 2563 Repeat end: 2574 |
| Forward primer | Primer sequence: GCTGAACAGGAAGTTGCACG Tm(°C): 60.041 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: CACCTTCACATGTTCCCGGA Tm(°C): 59.964 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 2538 End: 2846 Product size (bp): 309 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: 101250296 NCBI Gene Symbol: LOC101250296 |
| Gene Aliases | |
| Gene description & Other designations | Description: pre-mRNA-processing protein 40C Other designations: pre-mRNA-processing protein 40C |
| Chromosome, Strand & Exon count | Chromosome: 4 Strand: plus Exon count: 20 |
| Gene Location within genomic sequence | Genomic accession No. NC_015441.3 Gene Start and end within genomic accession: 2355972 ...... 2378893 |
| CDS Sequence | 101250296 |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: ACTGCTACAGTTTCACCCGG Tm(°C): 59.965 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TTTCAGTCCGGTGAGCAGTC Tm(°C): 59.966 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 852 End: 1323 Product size (bp): 472 |
| JBrowse View | JBrowse |
