PlantPathMarks Database

Statistics

Number of enzymes: 1

Total Number of designed primers: 33

Number of PGTM primers: 6

Number of PMTM primers: 27

Number of Failed designed PMTM primers: 1

Enzyme Id: K12823
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 101248651 NCBI Gene Symbol: LOC101248651
Gene Aliases
Gene description & Other designations	Description: ATP-dependent RNA helicase-like protein DB10 Other designations: ATP-dependent RNA helicase-like protein DB10
Chromosome, Strand & Exon count	Chromosome: 12 Strand: plus Exon count: 9
Gene Location within genomic sequence	Genomic accession No. NC_015449.3 Gene Start and end within genomic accession: 38726988 ...... 38734204
CDS Sequence	101248651
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Tri Repeat sequence: (CAA)3
Repeat start & end within CDS	Repeat start: 273 Repeat end: 281
Forward primer	Primer sequence: CCAGACGGTAGGCATAGCAG Tm(°C): 59.967 GC (%): 60 Size: 20
Reverse primer	Primer sequence: TCTGAAGGAAACCCAGTCGC Tm(°C): 59.965 GC (%): 55 Size: 20
Primer start, end within sequence and product size	Start: 246 End: 466 Product size (bp): 221
JBrowse View	JBrowse

Enzyme Id: K12823
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 101248651 NCBI Gene Symbol: LOC101248651
Gene Aliases
Gene description & Other designations	Description: ATP-dependent RNA helicase-like protein DB10 Other designations: ATP-dependent RNA helicase-like protein DB10
Chromosome, Strand & Exon count	Chromosome: 12 Strand: plus Exon count: 9
Gene Location within genomic sequence	Genomic accession No. NC_015449.3 Gene Start and end within genomic accession: 38726988 ...... 38734204
CDS Sequence	101248651
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Hexa Repeat sequence: (AAGCTG)2
Repeat start & end within CDS	Repeat start: 704 Repeat end: 715
Forward primer	Primer sequence: GCGACTGGGTTTCCTTCAGA Tm(°C): 59.965 GC (%): 55 Size: 20
Reverse primer	Primer sequence: TGAGGACCTTTTGGAGCACC Tm(°C): 59.89 GC (%): 55 Size: 20
Primer start, end within sequence and product size	Start: 447 End: 781 Product size (bp): 335
JBrowse View	JBrowse

Enzyme Id: K12823
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 101248651 NCBI Gene Symbol: LOC101248651
Gene Aliases
Gene description & Other designations	Description: ATP-dependent RNA helicase-like protein DB10 Other designations: ATP-dependent RNA helicase-like protein DB10
Chromosome, Strand & Exon count	Chromosome: 12 Strand: plus Exon count: 9
Gene Location within genomic sequence	Genomic accession No. NC_015449.3 Gene Start and end within genomic accession: 38726988 ...... 38734204
CDS Sequence	101248651
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Penta Repeat sequence: (TTCAG)2
Repeat start & end within CDS	Repeat start: 1041 Repeat end: 1050
Forward primer	Primer sequence: GCCAAAGGGGGTTCGTAAGA Tm(°C): 59.963 GC (%): 55 Size: 20
Reverse primer	Primer sequence: TTGTTTGCAGCAAGCTCGTC Tm(°C): 59.971 GC (%): 50 Size: 20
Primer start, end within sequence and product size	Start: 998 End: 1087 Product size (bp): 90
JBrowse View	JBrowse

Enzyme Id: K12823
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 101248651 NCBI Gene Symbol: LOC101248651
Gene Aliases
Gene description & Other designations	Description: ATP-dependent RNA helicase-like protein DB10 Other designations: ATP-dependent RNA helicase-like protein DB10
Chromosome, Strand & Exon count	Chromosome: 12 Strand: plus Exon count: 9
Gene Location within genomic sequence	Genomic accession No. NC_015449.3 Gene Start and end within genomic accession: 38726988 ...... 38734204
CDS Sequence	101248651
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Penta Repeat sequence: (GTCTT)2
Repeat start & end within CDS	Repeat start: 1111 Repeat end: 1120
Forward primer	Primer sequence: GCCAAAGGGGGTTCGTAAGA Tm(°C): 59.963 GC (%): 55 Size: 20
Reverse primer	Primer sequence: AGTCGCCGTTGTTTCTCCAT Tm(°C): 59.965 GC (%): 50 Size: 20
Primer start, end within sequence and product size	Start: 998 End: 1141 Product size (bp): 144
JBrowse View	JBrowse

Enzyme Id: K12823
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 101248651 NCBI Gene Symbol: LOC101248651
Gene Aliases
Gene description & Other designations	Description: ATP-dependent RNA helicase-like protein DB10 Other designations: ATP-dependent RNA helicase-like protein DB10
Chromosome, Strand & Exon count	Chromosome: 12 Strand: plus Exon count: 9
Gene Location within genomic sequence	Genomic accession No. NC_015449.3 Gene Start and end within genomic accession: 38726988 ...... 38734204
CDS Sequence	101248651
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Tri Repeat sequence: (GGT)3
Repeat start & end within CDS	Repeat start: 1380 Repeat end: 1388
Forward primer	Primer sequence: GAGCAGCTGCAATTCATGGG Tm(°C): 59.898 GC (%): 55 Size: 20
Reverse primer	Primer sequence: CTCGCGAAACCATATCACGC Tm(°C): 59.77 GC (%): 55 Size: 20
Primer start, end within sequence and product size	Start: 1246 End: 1578 Product size (bp): 333
JBrowse View	JBrowse

Enzyme Id: K12823
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 101248651 NCBI Gene Symbol: LOC101248651
Gene Aliases
Gene description & Other designations	Description: ATP-dependent RNA helicase-like protein DB10 Other designations: ATP-dependent RNA helicase-like protein DB10
Chromosome, Strand & Exon count	Chromosome: 12 Strand: plus Exon count: 9
Gene Location within genomic sequence	Genomic accession No. NC_015449.3 Gene Start and end within genomic accession: 38726988 ...... 38734204
CDS Sequence	101248651
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Penta Repeat sequence: (TCTGG)2
Repeat start & end within CDS	Repeat start: 1459 Repeat end: 1468
Forward primer	Primer sequence: GAGCAGCTGCAATTCATGGG Tm(°C): 59.898 GC (%): 55 Size: 20
Reverse primer	Primer sequence: CTCGCGAAACCATATCACGC Tm(°C): 59.77 GC (%): 55 Size: 20
Primer start, end within sequence and product size	Start: 1246 End: 1578 Product size (bp): 333
JBrowse View	JBrowse

Enzyme Id: K12823
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 101248651 NCBI Gene Symbol: LOC101248651
Gene Aliases
Gene description & Other designations	Description: ATP-dependent RNA helicase-like protein DB10 Other designations: ATP-dependent RNA helicase-like protein DB10
Chromosome, Strand & Exon count	Chromosome: 12 Strand: plus Exon count: 9
Gene Location within genomic sequence	Genomic accession No. NC_015449.3 Gene Start and end within genomic accession: 38726988 ...... 38734204
CDS Sequence	101248651
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Compound Repeat sequence: (AACTG)2cgtgatatggtttcgcga(GGT)3
Repeat start & end within CDS	Repeat start: 1551 Repeat end: 1587
Forward primer	Primer sequence: CCGTGCTTGTGGCTACTGAT Tm(°C): 60.392 GC (%): 55 Size: 20
Reverse primer	Primer sequence: CACGTCCACCTTGACCAGAA Tm(°C): 59.894 GC (%): 55 Size: 20
Primer start, end within sequence and product size	Start: 1324 End: 1626 Product size (bp): 303
JBrowse View	JBrowse

Enzyme Id: K12823
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 101248651 NCBI Gene Symbol: LOC101248651
Gene Aliases
Gene description & Other designations	Description: ATP-dependent RNA helicase-like protein DB10 Other designations: ATP-dependent RNA helicase-like protein DB10
Chromosome, Strand & Exon count	Chromosome: 12 Strand: plus Exon count: 9
Gene Location within genomic sequence	Genomic accession No. NC_015449.3 Gene Start and end within genomic accession: 38726988 ...... 38734204
CDS Sequence	101248651
	Marker Information
Marker Type	PGTM
Repeat type & sequence	Repeat type: Repeat sequence:
Repeat start & end within CDS	Repeat start: Repeat end:
Forward primer	Primer sequence: CCAGACGGTAGGCATAGCAG Tm(°C): 59.967 GC (%): 60 Size: 20
Reverse primer	Primer sequence: TCTGAAGGAAACCCAGTCGC Tm(°C): 59.965 GC (%): 55 Size: 20
Primer start, end within sequence and product size	Start: 246 End: 466 Product size (bp): 221
JBrowse View	JBrowse

Enzyme Id: K12823
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 101254752 NCBI Gene Symbol: LOC101254752
Gene Aliases
Gene description & Other designations	Description: ATP-dependent RNA helicase-like protein DB10 Other designations: ATP-dependent RNA helicase-like protein DB10
Chromosome, Strand & Exon count	Chromosome: 2 Strand: minus Exon count: 9
Gene Location within genomic sequence	Genomic accession No. NC_015439.3 Gene Start and end within genomic accession: 49944354 ...... 49954461
CDS Sequence	101254752
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Hexa Repeat sequence: (TCTGTA)2
Repeat start & end within CDS	Repeat start: 193 Repeat end: 204
Forward primer	Primer sequence: GGTCCACGTTATGCACCAGA Tm(°C): 60.037 GC (%): 55 Size: 20
Reverse primer	Primer sequence: GTTTCATCGCGGGAAAGCTC Tm(°C): 59.903 GC (%): 55 Size: 20
Primer start, end within sequence and product size	Start: 30 End: 343 Product size (bp): 314
JBrowse View	JBrowse

Enzyme Id: K12823
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 101254752 NCBI Gene Symbol: LOC101254752
Gene Aliases
Gene description & Other designations	Description: ATP-dependent RNA helicase-like protein DB10 Other designations: ATP-dependent RNA helicase-like protein DB10
Chromosome, Strand & Exon count	Chromosome: 2 Strand: minus Exon count: 9
Gene Location within genomic sequence	Genomic accession No. NC_015439.3 Gene Start and end within genomic accession: 49944354 ...... 49954461
CDS Sequence	101254752
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Tri Repeat sequence: (TTG)3
Repeat start & end within CDS	Repeat start: 833 Repeat end: 841
Forward primer	Primer sequence: CAAAAGGCCCTCAGCTACGA Tm(°C): 60.036 GC (%): 55 Size: 20
Reverse primer	Primer sequence: TCCAGCATACGATCCGCTTC Tm(°C): 59.968 GC (%): 55 Size: 20
Primer start, end within sequence and product size	Start: 790 End: 937 Product size (bp): 148
JBrowse View	JBrowse

Enzyme Id: K12823
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 101254752 NCBI Gene Symbol: LOC101254752
Gene Aliases
Gene description & Other designations	Description: ATP-dependent RNA helicase-like protein DB10 Other designations: ATP-dependent RNA helicase-like protein DB10
Chromosome, Strand & Exon count	Chromosome: 2 Strand: minus Exon count: 9
Gene Location within genomic sequence	Genomic accession No. NC_015439.3 Gene Start and end within genomic accession: 49944354 ...... 49954461
CDS Sequence	101254752
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Tri Repeat sequence: (GCT)3
Repeat start & end within CDS	Repeat start: 1270 Repeat end: 1278
Forward primer	Primer sequence: TGAGATCCCAAGAGCCTGGA Tm(°C): 59.957 GC (%): 55 Size: 20
Reverse primer	Primer sequence: CAGTTGCAACAAGAACGGGG Tm(°C): 59.969 GC (%): 55 Size: 20
Primer start, end within sequence and product size	Start: 1174 End: 1362 Product size (bp): 189
JBrowse View	JBrowse

Enzyme Id: K12823
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 101254752 NCBI Gene Symbol: LOC101254752
Gene Aliases
Gene description & Other designations	Description: ATP-dependent RNA helicase-like protein DB10 Other designations: ATP-dependent RNA helicase-like protein DB10
Chromosome, Strand & Exon count	Chromosome: 2 Strand: minus Exon count: 9
Gene Location within genomic sequence	Genomic accession No. NC_015439.3 Gene Start and end within genomic accession: 49944354 ...... 49954461
CDS Sequence	101254752
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Tri Repeat sequence: (GGT)3
Repeat start & end within CDS	Repeat start: 1401 Repeat end: 1409
Forward primer	Primer sequence: CCCCGTTCTTGTTGCAACTG Tm(°C): 59.969 GC (%): 55 Size: 20
Reverse primer	Primer sequence: CCCATACCACCTCCTCGAGA Tm(°C): 60.106 GC (%): 60 Size: 20
Primer start, end within sequence and product size	Start: 1343 End: 1612 Product size (bp): 270
JBrowse View	JBrowse

Enzyme Id: K12823
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 101254752 NCBI Gene Symbol: LOC101254752
Gene Aliases
Gene description & Other designations	Description: ATP-dependent RNA helicase-like protein DB10 Other designations: ATP-dependent RNA helicase-like protein DB10
Chromosome, Strand & Exon count	Chromosome: 2 Strand: minus Exon count: 9
Gene Location within genomic sequence	Genomic accession No. NC_015439.3 Gene Start and end within genomic accession: 49944354 ...... 49954461
CDS Sequence	101254752
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Hexa Repeat sequence: (ACTGCA)2
Repeat start & end within CDS	Repeat start: 10 Repeat end: 21
Forward primer	Primer sequence: None Tm(°C): GC (%): Size:
Reverse primer	Primer sequence: None Tm(°C): GC (%): Size:
Primer start, end within sequence and product size	Start: End: Product size (bp):
JBrowse View	JBrowse

Enzyme Id: K12823
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 101254752 NCBI Gene Symbol: LOC101254752
Gene Aliases
Gene description & Other designations	Description: ATP-dependent RNA helicase-like protein DB10 Other designations: ATP-dependent RNA helicase-like protein DB10
Chromosome, Strand & Exon count	Chromosome: 2 Strand: minus Exon count: 9
Gene Location within genomic sequence	Genomic accession No. NC_015439.3 Gene Start and end within genomic accession: 49944354 ...... 49954461
CDS Sequence	101254752
	Marker Information
Marker Type	PGTM
Repeat type & sequence	Repeat type: Repeat sequence:
Repeat start & end within CDS	Repeat start: Repeat end:
Forward primer	Primer sequence: GAAGCGGATCGTATGCTGGA Tm(°C): 59.968 GC (%): 55 Size: 20
Reverse primer	Primer sequence: CAGTTGCAACAAGAACGGGG Tm(°C): 59.969 GC (%): 55 Size: 20
Primer start, end within sequence and product size	Start: 918 End: 1362 Product size (bp): 445
JBrowse View	JBrowse

Enzyme Id: K12823
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 101258585 NCBI Gene Symbol: LOC101258585
Gene Aliases
Gene description & Other designations	Description: DEAD-box ATP-dependent RNA helicase 20 Other designations: ATP-dependent RNA helicase DBP2\|DEAD-box ATP-dependent RNA helicase 20
Chromosome, Strand & Exon count	Chromosome: 9 Strand: plus Exon count: 16
Gene Location within genomic sequence	Genomic accession No. NC_015446.3 Gene Start and end within genomic accession: 11381905 ...... 11400068
CDS Sequence	101258585
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Compound Repeat sequence: (GA)4(AGCTGC)2
Repeat start & end within CDS	Repeat start: 1519 Repeat end: 1538
Forward primer	Primer sequence: CCGGATTGGAAGGACTGGTC Tm(°C): 60.108 GC (%): 60 Size: 20
Reverse primer	Primer sequence: CATCTGCAGCTCCCTCCTTT Tm(°C): 59.745 GC (%): 55 Size: 20
Primer start, end within sequence and product size	Start: 1358 End: 1659 Product size (bp): 302
JBrowse View	JBrowse

Enzyme Id: K12823
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 101258585 NCBI Gene Symbol: LOC101258585
Gene Aliases
Gene description & Other designations	Description: DEAD-box ATP-dependent RNA helicase 20 Other designations: ATP-dependent RNA helicase DBP2\|DEAD-box ATP-dependent RNA helicase 20
Chromosome, Strand & Exon count	Chromosome: 9 Strand: plus Exon count: 16
Gene Location within genomic sequence	Genomic accession No. NC_015446.3 Gene Start and end within genomic accession: 11381905 ...... 11400068
CDS Sequence	101258585
	Marker Information
Marker Type	PGTM
Repeat type & sequence	Repeat type: Repeat sequence:
Repeat start & end within CDS	Repeat start: Repeat end:
Forward primer	Primer sequence: GCAACTGCACTTCATGGTGG Tm(°C): 60.039 GC (%): 55 Size: 20
Reverse primer	Primer sequence: CTCCAGTGACATCCAACCCC Tm(°C): 60.035 GC (%): 60 Size: 20
Primer start, end within sequence and product size	Start: 1179 End: 1305 Product size (bp): 127
JBrowse View	JBrowse

Enzyme Id: K12823
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 101265421 NCBI Gene Symbol: LOC101265421
Gene Aliases
Gene description & Other designations	Description: DEAD-box ATP-dependent RNA helicase 20 Other designations: DEAD-box ATP-dependent RNA helicase 20
Chromosome, Strand & Exon count	Chromosome: 3 Strand: plus Exon count: 10
Gene Location within genomic sequence	Genomic accession No. NC_015440.3 Gene Start and end within genomic accession: 64258370 ...... 64267257
CDS Sequence	101265421
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Tri Repeat sequence: (TGG)3
Repeat start & end within CDS	Repeat start: 228 Repeat end: 236
Forward primer	Primer sequence: CCGCTTCCTTATGGAGGTCC Tm(°C): 59.893 GC (%): 60 Size: 20
Reverse primer	Primer sequence: CCCATATCCGACCCTCTTGC Tm(°C): 59.965 GC (%): 60 Size: 20
Primer start, end within sequence and product size	Start: 141 End: 280 Product size (bp): 140
JBrowse View	JBrowse

Enzyme Id: K12823
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 101265421 NCBI Gene Symbol: LOC101265421
Gene Aliases
Gene description & Other designations	Description: DEAD-box ATP-dependent RNA helicase 20 Other designations: DEAD-box ATP-dependent RNA helicase 20
Chromosome, Strand & Exon count	Chromosome: 3 Strand: plus Exon count: 10
Gene Location within genomic sequence	Genomic accession No. NC_015440.3 Gene Start and end within genomic accession: 64258370 ...... 64267257
CDS Sequence	101265421
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Hexa Repeat sequence: (TGGAGG)2
Repeat start & end within CDS	Repeat start: 288 Repeat end: 299
Forward primer	Primer sequence: CAAGAGGGTCGGATATGGGC Tm(°C): 59.965 GC (%): 60 Size: 20
Reverse primer	Primer sequence: AAACCCCTACCTCCTCTCCC Tm(°C): 59.956 GC (%): 60 Size: 20
Primer start, end within sequence and product size	Start: 262 End: 412 Product size (bp): 151
JBrowse View	JBrowse

Enzyme Id: K12823
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 101265421 NCBI Gene Symbol: LOC101265421
Gene Aliases
Gene description & Other designations	Description: DEAD-box ATP-dependent RNA helicase 20 Other designations: DEAD-box ATP-dependent RNA helicase 20
Chromosome, Strand & Exon count	Chromosome: 3 Strand: plus Exon count: 10
Gene Location within genomic sequence	Genomic accession No. NC_015440.3 Gene Start and end within genomic accession: 64258370 ...... 64267257
CDS Sequence	101265421
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Tri Repeat sequence: (GTG)5
Repeat start & end within CDS	Repeat start: 380 Repeat end: 394
Forward primer	Primer sequence: CAAGAGGGTCGGATATGGGC Tm(°C): 59.965 GC (%): 60 Size: 20
Reverse primer	Primer sequence: CTCCCATGCCTACCTCCTCT Tm(°C): 60.105 GC (%): 60 Size: 20
Primer start, end within sequence and product size	Start: 262 End: 505 Product size (bp): 244
JBrowse View	JBrowse

Enzyme Id: K12823
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 101265421 NCBI Gene Symbol: LOC101265421
Gene Aliases
Gene description & Other designations	Description: DEAD-box ATP-dependent RNA helicase 20 Other designations: DEAD-box ATP-dependent RNA helicase 20
Chromosome, Strand & Exon count	Chromosome: 3 Strand: plus Exon count: 10
Gene Location within genomic sequence	Genomic accession No. NC_015440.3 Gene Start and end within genomic accession: 64258370 ...... 64267257
CDS Sequence	101265421
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Tri Repeat sequence: (AAG)3
Repeat start & end within CDS	Repeat start: 959 Repeat end: 967
Forward primer	Primer sequence: TGCTGAAACCGGTTCTGGAA Tm(°C): 59.818 GC (%): 50 Size: 20
Reverse primer	Primer sequence: TCTATTAACCGACCGGGGGT Tm(°C): 60.032 GC (%): 55 Size: 20
Primer start, end within sequence and product size	Start: 818 End: 1096 Product size (bp): 279
JBrowse View	JBrowse

Enzyme Id: K12823
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 101265421 NCBI Gene Symbol: LOC101265421
Gene Aliases
Gene description & Other designations	Description: DEAD-box ATP-dependent RNA helicase 20 Other designations: DEAD-box ATP-dependent RNA helicase 20
Chromosome, Strand & Exon count	Chromosome: 3 Strand: plus Exon count: 10
Gene Location within genomic sequence	Genomic accession No. NC_015440.3 Gene Start and end within genomic accession: 64258370 ...... 64267257
CDS Sequence	101265421
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Tetra Repeat sequence: (ATGG)3
Repeat start & end within CDS	Repeat start: 1489 Repeat end: 1500
Forward primer	Primer sequence: CGCTGGCTAGGCAGTTTCTA Tm(°C): 59.824 GC (%): 55 Size: 20
Reverse primer	Primer sequence: CCAATCCCTCTCATCCTGGC Tm(°C): 59.89 GC (%): 60 Size: 20
Primer start, end within sequence and product size	Start: 1270 End: 1547 Product size (bp): 278
JBrowse View	JBrowse

Enzyme Id: K12823
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 101265421 NCBI Gene Symbol: LOC101265421
Gene Aliases
Gene description & Other designations	Description: DEAD-box ATP-dependent RNA helicase 20 Other designations: DEAD-box ATP-dependent RNA helicase 20
Chromosome, Strand & Exon count	Chromosome: 3 Strand: plus Exon count: 10
Gene Location within genomic sequence	Genomic accession No. NC_015440.3 Gene Start and end within genomic accession: 64258370 ...... 64267257
CDS Sequence	101265421
	Marker Information
Marker Type	PGTM
Repeat type & sequence	Repeat type: Repeat sequence:
Repeat start & end within CDS	Repeat start: Repeat end:
Forward primer	Primer sequence: AGGATTGGCAGAACTGGACG Tm(°C): 60.036 GC (%): 55 Size: 20
Reverse primer	Primer sequence: AGACCCAGATCTCTGTCCCC Tm(°C): 60.032 GC (%): 60 Size: 20
Primer start, end within sequence and product size	Start: 1683 End: 1916 Product size (bp): 234
JBrowse View	JBrowse

Enzyme Id: K12823
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 101266555 NCBI Gene Symbol: LOC101266555
Gene Aliases
Gene description & Other designations	Description: DEAD-box ATP-dependent RNA helicase 46 Other designations: DEAD-box ATP-dependent RNA helicase 46
Chromosome, Strand & Exon count	Chromosome: 1 Strand: plus Exon count: 8
Gene Location within genomic sequence	Genomic accession No. NC_015438.3 Gene Start and end within genomic accession: 63610736 ...... 63619217
CDS Sequence	101266555
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Hexa Repeat sequence: (CAAGCA)2
Repeat start & end within CDS	Repeat start: 559 Repeat end: 570
Forward primer	Primer sequence: TAATCAGCCAGGGCCACATG Tm(°C): 60.107 GC (%): 55 Size: 20
Reverse primer	Primer sequence: CTGTCCCTGTGGAGGCAAAT Tm(°C): 59.961 GC (%): 55 Size: 20
Primer start, end within sequence and product size	Start: 491 End: 668 Product size (bp): 178
JBrowse View	JBrowse

Enzyme Id: K12823
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 101266555 NCBI Gene Symbol: LOC101266555
Gene Aliases
Gene description & Other designations	Description: DEAD-box ATP-dependent RNA helicase 46 Other designations: DEAD-box ATP-dependent RNA helicase 46
Chromosome, Strand & Exon count	Chromosome: 1 Strand: plus Exon count: 8
Gene Location within genomic sequence	Genomic accession No. NC_015438.3 Gene Start and end within genomic accession: 63610736 ...... 63619217
CDS Sequence	101266555
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Penta Repeat sequence: (TTCAC)2
Repeat start & end within CDS	Repeat start: 1516 Repeat end: 1525
Forward primer	Primer sequence: TGGGTTCCCGCCAGAAATAC Tm(°C): 60.035 GC (%): 55 Size: 20
Reverse primer	Primer sequence: ACTGGTGAACTTTGGGTGCA Tm(°C): 60.034 GC (%): 50 Size: 20
Primer start, end within sequence and product size	Start: 1472 End: 1803 Product size (bp): 332
JBrowse View	JBrowse

Enzyme Id: K12823
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 101266555 NCBI Gene Symbol: LOC101266555
Gene Aliases
Gene description & Other designations	Description: DEAD-box ATP-dependent RNA helicase 46 Other designations: DEAD-box ATP-dependent RNA helicase 46
Chromosome, Strand & Exon count	Chromosome: 1 Strand: plus Exon count: 8
Gene Location within genomic sequence	Genomic accession No. NC_015438.3 Gene Start and end within genomic accession: 63610736 ...... 63619217
CDS Sequence	101266555
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Compound Repeat sequence: (TTG)3caactcctggtcggcttaatgacatcct(TGAAA)2agaattgacttta gacaggt(TTCTC)2
Repeat start & end within CDS	Repeat start: 1832 Repeat end: 1908
Forward primer	Primer sequence: TGCACCCAAAGTTCACCAGT Tm(°C): 60.034 GC (%): 50 Size: 20
Reverse primer	Primer sequence: TTGGGCCAAGTTGCTGTGTA Tm(°C): 60.106 GC (%): 50 Size: 20
Primer start, end within sequence and product size	Start: 1784 End: 2023 Product size (bp): 240
JBrowse View	JBrowse

Enzyme Id: K12823
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 101266555 NCBI Gene Symbol: LOC101266555
Gene Aliases
Gene description & Other designations	Description: DEAD-box ATP-dependent RNA helicase 46 Other designations: DEAD-box ATP-dependent RNA helicase 46
Chromosome, Strand & Exon count	Chromosome: 1 Strand: plus Exon count: 8
Gene Location within genomic sequence	Genomic accession No. NC_015438.3 Gene Start and end within genomic accession: 63610736 ...... 63619217
CDS Sequence	101266555
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Di Repeat sequence: (GA)4
Repeat start & end within CDS	Repeat start: 2302 Repeat end: 2309
Forward primer	Primer sequence: GGTCGAAACTTTGGAGCTGC Tm(°C): 59.761 GC (%): 55 Size: 20
Reverse primer	Primer sequence: CCATCTCCCTAACATCCGGC Tm(°C): 59.965 GC (%): 60 Size: 20
Primer start, end within sequence and product size	Start: 2253 End: 2589 Product size (bp): 337
JBrowse View	JBrowse

Enzyme Id: K12823
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 101266555 NCBI Gene Symbol: LOC101266555
Gene Aliases
Gene description & Other designations	Description: DEAD-box ATP-dependent RNA helicase 46 Other designations: DEAD-box ATP-dependent RNA helicase 46
Chromosome, Strand & Exon count	Chromosome: 1 Strand: plus Exon count: 8
Gene Location within genomic sequence	Genomic accession No. NC_015438.3 Gene Start and end within genomic accession: 63610736 ...... 63619217
CDS Sequence	101266555
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Hexa Repeat sequence: (GATGGT)2
Repeat start & end within CDS	Repeat start: 2644 Repeat end: 2655
Forward primer	Primer sequence: CCGGATGTTAGGGAGATGGC Tm(°C): 59.965 GC (%): 60 Size: 20
Reverse primer	Primer sequence: ACCCACCATCTCTCATCCCA Tm(°C): 59.955 GC (%): 55 Size: 20
Primer start, end within sequence and product size	Start: 2571 End: 2838 Product size (bp): 268
JBrowse View	JBrowse

Enzyme Id: K12823
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 101266555 NCBI Gene Symbol: LOC101266555
Gene Aliases
Gene description & Other designations	Description: DEAD-box ATP-dependent RNA helicase 46 Other designations: DEAD-box ATP-dependent RNA helicase 46
Chromosome, Strand & Exon count	Chromosome: 1 Strand: plus Exon count: 8
Gene Location within genomic sequence	Genomic accession No. NC_015438.3 Gene Start and end within genomic accession: 63610736 ...... 63619217
CDS Sequence	101266555
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Compound Repeat sequence: (TAGTCC)2(AG)4ttcgaacatggggtagt(AGAAGC)2
Repeat start & end within CDS	Repeat start: 3120 Repeat end: 3168
Forward primer	Primer sequence: GTGGTGCTCAAAGTGCTTGG Tm(°C): 59.969 GC (%): 55 Size: 20
Reverse primer	Primer sequence: GACTACGACTACGACTGCGG Tm(°C): 59.974 GC (%): 60 Size: 20
Primer start, end within sequence and product size	Start: 2986 End: 3288 Product size (bp): 303
JBrowse View	JBrowse

Enzyme Id: K12823
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 101266555 NCBI Gene Symbol: LOC101266555
Gene Aliases
Gene description & Other designations	Description: DEAD-box ATP-dependent RNA helicase 46 Other designations: DEAD-box ATP-dependent RNA helicase 46
Chromosome, Strand & Exon count	Chromosome: 1 Strand: plus Exon count: 8
Gene Location within genomic sequence	Genomic accession No. NC_015438.3 Gene Start and end within genomic accession: 63610736 ...... 63619217
CDS Sequence	101266555
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Compound Repeat sequence: (AGCCGC)3agcctcagccgc(AGTCGT)3gatagatatcaaaggaggcctcgcc aaagtaagttcgatcagatg(GATCCA)2
Repeat start & end within CDS	Repeat start: 3244 Repeat end: 3348
Forward primer	Primer sequence: GAGTTACAGCCGAAGCCGTA Tm(°C): 59.828 GC (%): 55 Size: 20
Reverse primer	Primer sequence: TCCTGGCAACCCATTTCCTC Tm(°C): 59.96 GC (%): 55 Size: 20
Primer start, end within sequence and product size	Start: 3200 End: 3524 Product size (bp): 325
JBrowse View	JBrowse

Enzyme Id: K12823
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 101266555 NCBI Gene Symbol: LOC101266555
Gene Aliases
Gene description & Other designations	Description: DEAD-box ATP-dependent RNA helicase 46 Other designations: DEAD-box ATP-dependent RNA helicase 46
Chromosome, Strand & Exon count	Chromosome: 1 Strand: plus Exon count: 8
Gene Location within genomic sequence	Genomic accession No. NC_015438.3 Gene Start and end within genomic accession: 63610736 ...... 63619217
CDS Sequence	101266555
	Marker Information
Marker Type	PGTM
Repeat type & sequence	Repeat type: Repeat sequence:
Repeat start & end within CDS	Repeat start: Repeat end:
Forward primer	Primer sequence: GTGGTGCTCAAAGTGCTTGG Tm(°C): 59.969 GC (%): 55 Size: 20
Reverse primer	Primer sequence: GACTACGACTACGACTGCGG Tm(°C): 59.974 GC (%): 60 Size: 20
Primer start, end within sequence and product size	Start: 2986 End: 3288 Product size (bp): 303
JBrowse View	JBrowse

Enzyme Id: K12823
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 544216 NCBI Gene Symbol: ER68
Gene Aliases
Gene description & Other designations	Description: ethylene-responsive RNA helicase Other designations: ethylene-responsive RNA helicase
Chromosome, Strand & Exon count	Chromosome: 12 Strand: minus Exon count: 10
Gene Location within genomic sequence	Genomic accession No. NC_015449.3 Gene Start and end within genomic accession: 61142615 ...... 61149888
CDS Sequence	544216
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Tri Repeat sequence: (TCA)3
Repeat start & end within CDS	Repeat start: 91 Repeat end: 99
Forward primer	Primer sequence: AGTGATTCAGGCTTCGGTGG Tm(°C): 60.036 GC (%): 55 Size: 20
Reverse primer	Primer sequence: TTAACCTTCCGTGGCGACTC Tm(°C): 60.038 GC (%): 55 Size: 20
Primer start, end within sequence and product size	Start: 54 End: 145 Product size (bp): 92
JBrowse View	JBrowse

Enzyme Id: K12823
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 544216 NCBI Gene Symbol: ER68
Gene Aliases
Gene description & Other designations	Description: ethylene-responsive RNA helicase Other designations: ethylene-responsive RNA helicase
Chromosome, Strand & Exon count	Chromosome: 12 Strand: minus Exon count: 10
Gene Location within genomic sequence	Genomic accession No. NC_015449.3 Gene Start and end within genomic accession: 61142615 ...... 61149888
CDS Sequence	544216
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Compound Repeat sequence: (AGGTG)2gaagagtata(GAC)3
Repeat start & end within CDS	Repeat start: 216 Repeat end: 244
Forward primer	Primer sequence: GAGTCGCCACGGAAGGTTAA Tm(°C): 60.038 GC (%): 55 Size: 20
Reverse primer	Primer sequence: TGCCAATGAGATCACGACCC Tm(°C): 60.108 GC (%): 55 Size: 20
Primer start, end within sequence and product size	Start: 126 End: 414 Product size (bp): 289
JBrowse View	JBrowse

Enzyme Id: K12823
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 544216 NCBI Gene Symbol: ER68
Gene Aliases
Gene description & Other designations	Description: ethylene-responsive RNA helicase Other designations: ethylene-responsive RNA helicase
Chromosome, Strand & Exon count	Chromosome: 12 Strand: minus Exon count: 10
Gene Location within genomic sequence	Genomic accession No. NC_015449.3 Gene Start and end within genomic accession: 61142615 ...... 61149888
CDS Sequence	544216
	Marker Information
Marker Type	PMTM
Repeat type & sequence	Repeat type: Penta Repeat sequence: (GCCCA)2
Repeat start & end within CDS	Repeat start: 478 Repeat end: 487
Forward primer	Primer sequence: GGGTCGTGATCTCATTGGCA Tm(°C): 60.108 GC (%): 55 Size: 20
Reverse primer	Primer sequence: TCACGAGTTGGGGCTAACAC Tm(°C): 59.966 GC (%): 55 Size: 20
Primer start, end within sequence and product size	Start: 395 End: 538 Product size (bp): 144
JBrowse View	JBrowse

Enzyme Id: K12823
	Gene Information
NCBI Gene Accession Number & Symbol	Accession Number: 544216 NCBI Gene Symbol: ER68
Gene Aliases
Gene description & Other designations	Description: ethylene-responsive RNA helicase Other designations: ethylene-responsive RNA helicase
Chromosome, Strand & Exon count	Chromosome: 12 Strand: minus Exon count: 10
Gene Location within genomic sequence	Genomic accession No. NC_015449.3 Gene Start and end within genomic accession: 61142615 ...... 61149888
CDS Sequence	544216
	Marker Information
Marker Type	PGTM
Repeat type & sequence	Repeat type: Repeat sequence:
Repeat start & end within CDS	Repeat start: Repeat end:
Forward primer	Primer sequence: AGTGATTCAGGCTTCGGTGG Tm(°C): 60.036 GC (%): 55 Size: 20
Reverse primer	Primer sequence: TCACGAGTTGGGGCTAACAC Tm(°C): 59.966 GC (%): 55 Size: 20
Primer start, end within sequence and product size	Start: 54 End: 538 Product size (bp): 485
JBrowse View	JBrowse