image


Statistics

Number of enzymes: 1
Total Number of designed primers: 10
Number of PGTM primers:     1
Number of PMTM primers:     9

Enzyme Id:  K12811

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101254580     NCBI Gene Symbol: LOC101254580
Gene Aliases
Gene description & Other designations Description:   DEAD-box ATP-dependent RNA helicase 42      Other designations:   DEAD-box ATP-dependent RNA helicase 42
Chromosome, Strand & Exon count Chromosome:   12     Strand:   plus     Exon count:   2
Gene Location within genomic sequence Genomic accession No. NC_015449.3      Gene Start and end within genomic accession: 67100608 ...... 67105623
CDS Sequence 101254580
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (AG)4gacgagtcgaagaagcggcaccgtgataaggag(GATCGA)2gagaagag
ggacagagag(CAT)3cgtgataagaaggatc(GA)6aaagcagtcggtatgaaa
gggagaaaagtgct(GATAGA)4
Repeat start & end within CDS Repeat start: 26     Repeat end: 189
Forward primer Primer sequence:   TGGAAGAGTTGAAGCACAAGT     Tm(°C): 57.718     GC (%): 42.857     Size: 21
Reverse primer Primer sequence:   TCATCACGAACCTTGCTGCT     Tm(°C): 59.965     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 1     End: 256     Product size (bp): 256
JBrowse View      JBrowse

Enzyme Id:  K12811

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101254580     NCBI Gene Symbol: LOC101254580
Gene Aliases
Gene description & Other designations Description:   DEAD-box ATP-dependent RNA helicase 42      Other designations:   DEAD-box ATP-dependent RNA helicase 42
Chromosome, Strand & Exon count Chromosome:   12     Strand:   plus     Exon count:   2
Gene Location within genomic sequence Genomic accession No. NC_015449.3      Gene Start and end within genomic accession: 67100608 ...... 67105623
CDS Sequence 101254580
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (TGA)4
Repeat start & end within CDS Repeat start: 252     Repeat end: 263
Forward primer Primer sequence:   AAGAAGCGGCACCGTGATAA     Tm(°C): 60.037     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CTTCTCCCTTTCCCTCTCGC     Tm(°C): 59.823     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 42     End: 380     Product size (bp): 339
JBrowse View      JBrowse

Enzyme Id:  K12811

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101254580     NCBI Gene Symbol: LOC101254580
Gene Aliases
Gene description & Other designations Description:   DEAD-box ATP-dependent RNA helicase 42      Other designations:   DEAD-box ATP-dependent RNA helicase 42
Chromosome, Strand & Exon count Chromosome:   12     Strand:   plus     Exon count:   2
Gene Location within genomic sequence Genomic accession No. NC_015449.3      Gene Start and end within genomic accession: 67100608 ...... 67105623
CDS Sequence 101254580
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (AG)4(GAGAG)2*
Repeat start & end within CDS Repeat start: 469     Repeat end: 481
Forward primer Primer sequence:   AGCAGCAAGGTTCGTGATGA     Tm(°C): 59.965     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CGCGATTCCTCTCCTTCTCC     Tm(°C): 59.969     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 237     End: 504     Product size (bp): 268
JBrowse View      JBrowse

Enzyme Id:  K12811

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101254580     NCBI Gene Symbol: LOC101254580
Gene Aliases
Gene description & Other designations Description:   DEAD-box ATP-dependent RNA helicase 42      Other designations:   DEAD-box ATP-dependent RNA helicase 42
Chromosome, Strand & Exon count Chromosome:   12     Strand:   plus     Exon count:   2
Gene Location within genomic sequence Genomic accession No. NC_015449.3      Gene Start and end within genomic accession: 67100608 ...... 67105623
CDS Sequence 101254580
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (CAAAC)2
Repeat start & end within CDS Repeat start: 636     Repeat end: 645
Forward primer Primer sequence:   GGAGAAGGAGAGGAATCGCG     Tm(°C): 59.969     GC (%): 60     Size: 20
Reverse primer Primer sequence:   CAACCCCAAGTGTCTCCCTC     Tm(°C): 59.963     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 485     End: 831     Product size (bp): 347
JBrowse View      JBrowse

Enzyme Id:  K12811

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101254580     NCBI Gene Symbol: LOC101254580
Gene Aliases
Gene description & Other designations Description:   DEAD-box ATP-dependent RNA helicase 42      Other designations:   DEAD-box ATP-dependent RNA helicase 42
Chromosome, Strand & Exon count Chromosome:   12     Strand:   plus     Exon count:   2
Gene Location within genomic sequence Genomic accession No. NC_015449.3      Gene Start and end within genomic accession: 67100608 ...... 67105623
CDS Sequence 101254580
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (TGA)3
Repeat start & end within CDS Repeat start: 888     Repeat end: 896
Forward primer Primer sequence:   GAGGGAGACACTTGGGGTTG     Tm(°C): 59.963     GC (%): 60     Size: 20
Reverse primer Primer sequence:   ACTAACCACCTTGCCAGCTC     Tm(°C): 59.963     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 812     End: 986     Product size (bp): 175
JBrowse View      JBrowse

Enzyme Id:  K12811

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101254580     NCBI Gene Symbol: LOC101254580
Gene Aliases
Gene description & Other designations Description:   DEAD-box ATP-dependent RNA helicase 42      Other designations:   DEAD-box ATP-dependent RNA helicase 42
Chromosome, Strand & Exon count Chromosome:   12     Strand:   plus     Exon count:   2
Gene Location within genomic sequence Genomic accession No. NC_015449.3      Gene Start and end within genomic accession: 67100608 ...... 67105623
CDS Sequence 101254580
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (TGAGG)2
Repeat start & end within CDS Repeat start: 2178     Repeat end: 2187
Forward primer Primer sequence:   TTGTCCAAAACACCAGGCCA     Tm(°C): 60.325     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CCATGAAGGGAGAGACAGGG     Tm(°C): 59.164     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 2023     End: 2338     Product size (bp): 316
JBrowse View      JBrowse

Enzyme Id:  K12811

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101254580     NCBI Gene Symbol: LOC101254580
Gene Aliases
Gene description & Other designations Description:   DEAD-box ATP-dependent RNA helicase 42      Other designations:   DEAD-box ATP-dependent RNA helicase 42
Chromosome, Strand & Exon count Chromosome:   12     Strand:   plus     Exon count:   2
Gene Location within genomic sequence Genomic accession No. NC_015449.3      Gene Start and end within genomic accession: 67100608 ...... 67105623
CDS Sequence 101254580
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Di     Repeat sequence: (CA)4
Repeat start & end within CDS Repeat start: 2266     Repeat end: 2273
Forward primer Primer sequence:   ATTGGTTGAGGTGAGGCCAG     Tm(°C): 59.961     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GCCCCTGGCTGCTATACTAG     Tm(°C): 59.389     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 2171     End: 2432     Product size (bp): 262
JBrowse View      JBrowse

Enzyme Id:  K12811

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101254580     NCBI Gene Symbol: LOC101254580
Gene Aliases
Gene description & Other designations Description:   DEAD-box ATP-dependent RNA helicase 42      Other designations:   DEAD-box ATP-dependent RNA helicase 42
Chromosome, Strand & Exon count Chromosome:   12     Strand:   plus     Exon count:   2
Gene Location within genomic sequence Genomic accession No. NC_015449.3      Gene Start and end within genomic accession: 67100608 ...... 67105623
CDS Sequence 101254580
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (GATGAA)2
Repeat start & end within CDS Repeat start: 2812     Repeat end: 2823
Forward primer Primer sequence:   GCCAAGAAAGCACAGGCAAA     Tm(°C): 59.895     GC (%): 50     Size: 20
Reverse primer Primer sequence:   GCTGAAACTGGAGTTGCTGC     Tm(°C): 60.04     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 2754     End: 2935     Product size (bp): 182
JBrowse View      JBrowse

Enzyme Id:  K12811

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101254580     NCBI Gene Symbol: LOC101254580
Gene Aliases
Gene description & Other designations Description:   DEAD-box ATP-dependent RNA helicase 42      Other designations:   DEAD-box ATP-dependent RNA helicase 42
Chromosome, Strand & Exon count Chromosome:   12     Strand:   plus     Exon count:   2
Gene Location within genomic sequence Genomic accession No. NC_015449.3      Gene Start and end within genomic accession: 67100608 ...... 67105623
CDS Sequence 101254580
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GCT)3
Repeat start & end within CDS Repeat start: 2875     Repeat end: 2883
Forward primer Primer sequence:   GCCAAGAAAGCACAGGCAAA     Tm(°C): 59.895     GC (%): 50     Size: 20
Reverse primer Primer sequence:   GCTGAAACTGGAGTTGCTGC     Tm(°C): 60.04     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 2754     End: 2935     Product size (bp): 182
JBrowse View      JBrowse

Enzyme Id:  K12811

Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101254580     NCBI Gene Symbol: LOC101254580
Gene Aliases
Gene description & Other designations Description:   DEAD-box ATP-dependent RNA helicase 42      Other designations:   DEAD-box ATP-dependent RNA helicase 42
Chromosome, Strand & Exon count Chromosome:   12     Strand:   plus     Exon count:   2
Gene Location within genomic sequence Genomic accession No. NC_015449.3      Gene Start and end within genomic accession: 67100608 ...... 67105623
CDS Sequence 101254580
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   AGCAGCAAGGTTCGTGATGA     Tm(°C): 59.965     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CGCGATTCCTCTCCTTCTCC     Tm(°C): 59.969     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 237     End: 504     Product size (bp): 268
JBrowse View      JBrowse