image


Statistics

Number of enzymes: 1
Total Number of designed primers: 5
Number of PGTM primers:     1
Number of PMTM primers:     4

Enzyme Id:  K12662
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101256472     NCBI Gene Symbol: LOC101256472
Gene Aliases
Gene description & Other designations Description:   U4/U6 small nuclear ribonucleoprotein PRP4-like protein      Other designations:   U4/U6 small nuclear ribonucleoprotein PRP4-like protein
Chromosome, Strand & Exon count Chromosome:   4     Strand:   plus     Exon count:   6
Gene Location within genomic sequence Genomic accession No. NC_015441.3      Gene Start and end within genomic accession: 7334646 ...... 7339032
CDS Sequence 101256472
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (GATTCA)2
Repeat start & end within CDS Repeat start: 289     Repeat end: 300
Forward primer Primer sequence:   ACGGCTATCCTTCCTCCTGT     Tm(°C): 60.032     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GAGCTCGAACGGCCATATCA     Tm(°C): 59.968     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 144     End: 474     Product size (bp): 331
JBrowse View      JBrowse

Enzyme Id:  K12662
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101256472     NCBI Gene Symbol: LOC101256472
Gene Aliases
Gene description & Other designations Description:   U4/U6 small nuclear ribonucleoprotein PRP4-like protein      Other designations:   U4/U6 small nuclear ribonucleoprotein PRP4-like protein
Chromosome, Strand & Exon count Chromosome:   4     Strand:   plus     Exon count:   6
Gene Location within genomic sequence Genomic accession No. NC_015441.3      Gene Start and end within genomic accession: 7334646 ...... 7339032
CDS Sequence 101256472
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (TGC)3
Repeat start & end within CDS Repeat start: 429     Repeat end: 437
Forward primer Primer sequence:   ACGGCTATCCTTCCTCCTGT     Tm(°C): 60.032     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GAGCTCGAACGGCCATATCA     Tm(°C): 59.968     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 144     End: 474     Product size (bp): 331
JBrowse View      JBrowse

Enzyme Id:  K12662
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101256472     NCBI Gene Symbol: LOC101256472
Gene Aliases
Gene description & Other designations Description:   U4/U6 small nuclear ribonucleoprotein PRP4-like protein      Other designations:   U4/U6 small nuclear ribonucleoprotein PRP4-like protein
Chromosome, Strand & Exon count Chromosome:   4     Strand:   plus     Exon count:   6
Gene Location within genomic sequence Genomic accession No. NC_015441.3      Gene Start and end within genomic accession: 7334646 ...... 7339032
CDS Sequence 101256472
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (GTG)3
Repeat start & end within CDS Repeat start: 1412     Repeat end: 1420
Forward primer Primer sequence:   TTAGTGGCATCATGCGGGTT     Tm(°C): 60.035     GC (%): 50     Size: 20
Reverse primer Primer sequence:   ATCTTCTCTGCCGCAAGTCC     Tm(°C): 60.108     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1275     End: 1461     Product size (bp): 187
JBrowse View      JBrowse

Enzyme Id:  K12662
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101256472     NCBI Gene Symbol: LOC101256472
Gene Aliases
Gene description & Other designations Description:   U4/U6 small nuclear ribonucleoprotein PRP4-like protein      Other designations:   U4/U6 small nuclear ribonucleoprotein PRP4-like protein
Chromosome, Strand & Exon count Chromosome:   4     Strand:   plus     Exon count:   6
Gene Location within genomic sequence Genomic accession No. NC_015441.3      Gene Start and end within genomic accession: 7334646 ...... 7339032
CDS Sequence 101256472
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (TATGA)2
Repeat start & end within CDS Repeat start: 1549     Repeat end: 1558
Forward primer Primer sequence:   GGACTTGCGGCAGAGAAGAT     Tm(°C): 60.108     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TGTCCATCTGATGCAACATCCA     Tm(°C): 60.026     GC (%): 45.455     Size: 22
Primer start, end within sequence and product size Start: 1442     End: 1654     Product size (bp): 213
JBrowse View      JBrowse

Enzyme Id:  K12662
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   101256472     NCBI Gene Symbol: LOC101256472
Gene Aliases
Gene description & Other designations Description:   U4/U6 small nuclear ribonucleoprotein PRP4-like protein      Other designations:   U4/U6 small nuclear ribonucleoprotein PRP4-like protein
Chromosome, Strand & Exon count Chromosome:   4     Strand:   plus     Exon count:   6
Gene Location within genomic sequence Genomic accession No. NC_015441.3      Gene Start and end within genomic accession: 7334646 ...... 7339032
CDS Sequence 101256472
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   ACGGCTATCCTTCCTCCTGT     Tm(°C): 60.032     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GAGCTCGAACGGCCATATCA     Tm(°C): 59.968     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 144     End: 474     Product size (bp): 331
JBrowse View      JBrowse