|
| Gene Information | |
NCBI Gene Accession Number & Symbol | Accession Number: 103319759 NCBI Gene Symbol: LOC103319759 |
Gene Aliases | |
Gene description & Other designations | Description: UDP-sugar pyrophosphorylase Other designations: UDP-sugar pyrophosphorylase |
Chromosome, Strand & Exon count | Chromosome: LG2 Strand: minus Exon count: 17 |
Gene Location within genomic sequence | Genomic accession No. NC_024127.1 Gene Start and end within genomic accession: 6676266 ...... 6684232 |
CDS Sequence | 103319759 |
| Marker Information | |
Marker Type | PMTM |
Repeat type & sequence | Repeat type: Compound Repeat sequence: (CTACT)2ctagcggccttctaaatatttggcgtgaggctggtttgagatgg(GT
TCT)2 |
Repeat start & end within CDS | Repeat start: 805 Repeat end: 868 |
Forward primer | Primer sequence: GGGCATGGTGATGTGCATTC Tm(°C): 59.896 GC (%): 55 Size: 20 |
Reverse primer | Primer sequence: TTTTGCTTTCCGTGGCACAG Tm(°C): 59.898 GC (%): 50 Size: 20 |
Primer start, end within sequence and product size | Start: 783 End: 974 Product size (bp): 192 |
JBrowse View | JBrowse |
|
| Gene Information | |
NCBI Gene Accession Number & Symbol | Accession Number: 103319759 NCBI Gene Symbol: LOC103319759 |
Gene Aliases | |
Gene description & Other designations | Description: UDP-sugar pyrophosphorylase Other designations: UDP-sugar pyrophosphorylase |
Chromosome, Strand & Exon count | Chromosome: LG2 Strand: minus Exon count: 17 |
Gene Location within genomic sequence | Genomic accession No. NC_024127.1 Gene Start and end within genomic accession: 6676266 ...... 6684232 |
CDS Sequence | 103319759 |
| Marker Information | |
Marker Type | PMTM |
Repeat type & sequence | Repeat type: Hexa Repeat sequence: (AGAAGT)2 |
Repeat start & end within CDS | Repeat start: 1512 Repeat end: 1523 |
Forward primer | Primer sequence: CCGGAGTCCAAGTTGCTGAT Tm(°C): 60.036 GC (%): 55 Size: 20 |
Reverse primer | Primer sequence: GAGGACCCAGCCCTTGTTTT Tm(°C): 60.179 GC (%): 55 Size: 20 |
Primer start, end within sequence and product size | Start: 1465 End: 1745 Product size (bp): 281 |
JBrowse View | JBrowse |
|
| Gene Information | |
NCBI Gene Accession Number & Symbol | Accession Number: 103319759 NCBI Gene Symbol: LOC103319759 |
Gene Aliases | |
Gene description & Other designations | Description: UDP-sugar pyrophosphorylase Other designations: UDP-sugar pyrophosphorylase |
Chromosome, Strand & Exon count | Chromosome: LG2 Strand: minus Exon count: 17 |
Gene Location within genomic sequence | Genomic accession No. NC_024127.1 Gene Start and end within genomic accession: 6676266 ...... 6684232 |
CDS Sequence | 103319759 |
| Marker Information | |
Marker Type | PMTM |
Repeat type & sequence | Repeat type: Penta Repeat sequence: (GTTCA)2 |
Repeat start & end within CDS | Repeat start: 1718 Repeat end: 1727 |
Forward primer | Primer sequence: CCGGAGTCCAAGTTGCTGAT Tm(°C): 60.036 GC (%): 55 Size: 20 |
Reverse primer | Primer sequence: CCTCAGTTCCTCAGGTACCG Tm(°C): 59.182 GC (%): 60 Size: 20 |
Primer start, end within sequence and product size | Start: 1465 End: 1790 Product size (bp): 326 |
JBrowse View | JBrowse |
|
| Gene Information | |
NCBI Gene Accession Number & Symbol | Accession Number: 103319759 NCBI Gene Symbol: LOC103319759 |
Gene Aliases | |
Gene description & Other designations | Description: UDP-sugar pyrophosphorylase Other designations: UDP-sugar pyrophosphorylase |
Chromosome, Strand & Exon count | Chromosome: LG2 Strand: minus Exon count: 17 |
Gene Location within genomic sequence | Genomic accession No. NC_024127.1 Gene Start and end within genomic accession: 6676266 ...... 6684232 |
CDS Sequence | 103319759 |
| Marker Information | |
Marker Type | PGTM |
Repeat type & sequence | Repeat type: Repeat sequence: |
Repeat start & end within CDS | Repeat start: Repeat end: |
Forward primer | Primer sequence: GAAGCTATCGAACCTCGGCA Tm(°C): 59.898 GC (%): 55 Size: 20 |
Reverse primer | Primer sequence: CCGCCCAATGCTCAAACAAA Tm(°C): 59.967 GC (%): 50 Size: 20 |
Primer start, end within sequence and product size | Start: 29 End: 165 Product size (bp): 137 |
JBrowse View | JBrowse |