image


Statistics

Number of enzymes: 1
Total Number of designed primers: 14
Number of PGTM primers:     3
Number of PMTM primers:     11

Enzyme Id:  K12349
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103338337     NCBI Gene Symbol: LOC103338337
Gene Aliases
Gene description & Other designations Description:   neutral ceramidase      Other designations:   neutral ceramidase
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   minus     Exon count:   10
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 20259987 ...... 20264678
CDS Sequence 103338337
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (TGTTGG)2
Repeat start & end within CDS Repeat start: 44     Repeat end: 55
Forward primer Primer sequence:   TCCCTTCAGCATACCATATGGC     Tm(°C): 59.96     GC (%): 50     Size: 22
Reverse primer Primer sequence:   GACAATTTGGGAGGCCATGC     Tm(°C): 59.824     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 6     End: 293     Product size (bp): 288
JBrowse View      JBrowse

Enzyme Id:  K12349
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103338337     NCBI Gene Symbol: LOC103338337
Gene Aliases
Gene description & Other designations Description:   neutral ceramidase      Other designations:   neutral ceramidase
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   minus     Exon count:   10
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 20259987 ...... 20264678
CDS Sequence 103338337
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (CTG)3
Repeat start & end within CDS Repeat start: 137     Repeat end: 145
Forward primer Primer sequence:   GGGGTCTTCGTCATCAGCTT     Tm(°C): 59.749     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GACAATTTGGGAGGCCATGC     Tm(°C): 59.824     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 74     End: 293     Product size (bp): 220
JBrowse View      JBrowse

Enzyme Id:  K12349
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103338337     NCBI Gene Symbol: LOC103338337
Gene Aliases
Gene description & Other designations Description:   neutral ceramidase      Other designations:   neutral ceramidase
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   minus     Exon count:   10
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 20259987 ...... 20264678
CDS Sequence 103338337
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (AATGGA)2
Repeat start & end within CDS Repeat start: 883     Repeat end: 894
Forward primer Primer sequence:   CTGGTTTGAACGGCATGGTG     Tm(°C): 60.039     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GAAAGGAGGCGGCAAGTTTC     Tm(°C): 59.759     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 776     End: 924     Product size (bp): 149
JBrowse View      JBrowse

Enzyme Id:  K12349
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103338337     NCBI Gene Symbol: LOC103338337
Gene Aliases
Gene description & Other designations Description:   neutral ceramidase      Other designations:   neutral ceramidase
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   minus     Exon count:   10
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 20259987 ...... 20264678
CDS Sequence 103338337
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (TTTGCC)2
Repeat start & end within CDS Repeat start: 1363     Repeat end: 1374
Forward primer Primer sequence:   GAGGGGCTAATGAGGTGGTG     Tm(°C): 59.819     GC (%): 60     Size: 20
Reverse primer Primer sequence:   TAGGCTTTGGATGCTGGCAA     Tm(°C): 59.961     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 1318     End: 1509     Product size (bp): 192
JBrowse View      JBrowse

Enzyme Id:  K12349
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103338337     NCBI Gene Symbol: LOC103338337
Gene Aliases
Gene description & Other designations Description:   neutral ceramidase      Other designations:   neutral ceramidase
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   minus     Exon count:   10
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 20259987 ...... 20264678
CDS Sequence 103338337
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (ATG)4
Repeat start & end within CDS Repeat start: 2135     Repeat end: 2146
Forward primer Primer sequence:   GACCTCCTGACTGAAGGCAC     Tm(°C): 60.037     GC (%): 60     Size: 20
Reverse primer Primer sequence:   TGAAATGGCGAATCGACCCA     Tm(°C): 60.036     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 2064     End: 2304     Product size (bp): 241
JBrowse View      JBrowse

Enzyme Id:  K12349
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103338337     NCBI Gene Symbol: LOC103338337
Gene Aliases
Gene description & Other designations Description:   neutral ceramidase      Other designations:   neutral ceramidase
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   minus     Exon count:   10
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 20259987 ...... 20264678
CDS Sequence 103338337
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   GTGCAGAGATACGAGGGAGC     Tm(°C): 59.969     GC (%): 60     Size: 20
Reverse primer Primer sequence:   GTGCCTTCAGTCAGGAGGTC     Tm(°C): 60.037     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 1773     End: 2083     Product size (bp): 311
JBrowse View      JBrowse

Enzyme Id:  K12349
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103320284     NCBI Gene Symbol: LOC103320284
Gene Aliases
Gene description & Other designations Description:   neutral ceramidase      Other designations:   neutral ceramidase
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   plus     Exon count:   10
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 3161506 ...... 3167097
CDS Sequence 103320284
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (CTG)3
Repeat start & end within CDS Repeat start: 155     Repeat end: 163
Forward primer Primer sequence:   AGTTTTTGGGTCTCGGCGAT     Tm(°C): 59.964     GC (%): 50     Size: 20
Reverse primer Primer sequence:   AGCTCGCAACCTGAAGTGAA     Tm(°C): 59.893     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 4     End: 230     Product size (bp): 227
JBrowse View      JBrowse

Enzyme Id:  K12349
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103320284     NCBI Gene Symbol: LOC103320284
Gene Aliases
Gene description & Other designations Description:   neutral ceramidase      Other designations:   neutral ceramidase
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   plus     Exon count:   10
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 3161506 ...... 3167097
CDS Sequence 103320284
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (TGC)3
Repeat start & end within CDS Repeat start: 771     Repeat end: 779
Forward primer Primer sequence:   GCAGCTTCAACTGGTTTGCA     Tm(°C): 59.897     GC (%): 50     Size: 20
Reverse primer Primer sequence:   AGTTTGAGACTCTTCGCGGG     Tm(°C): 60.038     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 694     End: 873     Product size (bp): 180
JBrowse View      JBrowse

Enzyme Id:  K12349
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103320284     NCBI Gene Symbol: LOC103320284
Gene Aliases
Gene description & Other designations Description:   neutral ceramidase      Other designations:   neutral ceramidase
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   plus     Exon count:   10
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 3161506 ...... 3167097
CDS Sequence 103320284
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Di     Repeat sequence: (CA)4
Repeat start & end within CDS Repeat start: 1808     Repeat end: 1815
Forward primer Primer sequence:   GGTGCCTCCACTCTGTATGG     Tm(°C): 59.821     GC (%): 60     Size: 20
Reverse primer Primer sequence:   AACAGGTTTGCCACTGGTGA     Tm(°C): 60.034     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 1785     End: 1877     Product size (bp): 93
JBrowse View      JBrowse

Enzyme Id:  K12349
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103320284     NCBI Gene Symbol: LOC103320284
Gene Aliases
Gene description & Other designations Description:   neutral ceramidase      Other designations:   neutral ceramidase
Chromosome, Strand & Exon count Chromosome:   LG1     Strand:   plus     Exon count:   10
Gene Location within genomic sequence Genomic accession No. NC_024126.1      Gene Start and end within genomic accession: 3161506 ...... 3167097
CDS Sequence 103320284
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   TCACCAGTGGCAAACCTGTT     Tm(°C): 60.034     GC (%): 50     Size: 20
Reverse primer Primer sequence:   AGGACAAGCTGACCAGAACG     Tm(°C): 59.966     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1858     End: 2057     Product size (bp): 200
JBrowse View      JBrowse

Enzyme Id:  K12349
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103321371     NCBI Gene Symbol: LOC103321371
Gene Aliases
Gene description & Other designations Description:   neutral ceramidase-like      Other designations:   neutral ceramidase-like
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   plus     Exon count:   9
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 14910716 ...... 14915738
CDS Sequence 103321371
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (CATGA)2
Repeat start & end within CDS Repeat start: 91     Repeat end: 100
Forward primer Primer sequence:   AGGAGATGCAATGGCGAAGG     Tm(°C): 60.465     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCTTGCCCTGAGTCGGAAAT     Tm(°C): 60.035     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 48     End: 185     Product size (bp): 138
JBrowse View      JBrowse

Enzyme Id:  K12349
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103321371     NCBI Gene Symbol: LOC103321371
Gene Aliases
Gene description & Other designations Description:   neutral ceramidase-like      Other designations:   neutral ceramidase-like
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   plus     Exon count:   9
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 14910716 ...... 14915738
CDS Sequence 103321371
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (GAGCA)2
Repeat start & end within CDS Repeat start: 448     Repeat end: 457
Forward primer Primer sequence:   GGATTCACACTCACGCTGGA     Tm(°C): 60.037     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CAGCGTTTACCACATCCCCT     Tm(°C): 60.035     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 340     End: 525     Product size (bp): 186
JBrowse View      JBrowse

Enzyme Id:  K12349
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103321371     NCBI Gene Symbol: LOC103321371
Gene Aliases
Gene description & Other designations Description:   neutral ceramidase-like      Other designations:   neutral ceramidase-like
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   plus     Exon count:   9
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 14910716 ...... 14915738
CDS Sequence 103321371
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Compound     Repeat sequence: (CTC)3ttcctcctcgt(CTA)3
Repeat start & end within CDS Repeat start: 759     Repeat end: 787
Forward primer Primer sequence:   ACGGAACCTCCATGAGCAAG     Tm(°C): 60.036     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CGACCCGTTGTTCTTCCTCA     Tm(°C): 59.967     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 676     End: 935     Product size (bp): 260
JBrowse View      JBrowse

Enzyme Id:  K12349
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103321371     NCBI Gene Symbol: LOC103321371
Gene Aliases
Gene description & Other designations Description:   neutral ceramidase-like      Other designations:   neutral ceramidase-like
Chromosome, Strand & Exon count Chromosome:   LG2     Strand:   plus     Exon count:   9
Gene Location within genomic sequence Genomic accession No. NC_024127.1      Gene Start and end within genomic accession: 14910716 ...... 14915738
CDS Sequence 103321371
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   GGCCGCTCATCTATTCACGA     Tm(°C): 59.968     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCAGTGTCGAGCAGAACTGT     Tm(°C): 59.967     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1139     End: 1444     Product size (bp): 306
JBrowse View      JBrowse