image


Statistics

Number of enzymes: 1
Total Number of designed primers: 7
Number of PGTM primers:     1
Number of PMTM primers:     6

Enzyme Id:  K12309
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103327697     NCBI Gene Symbol: LOC103327697
Gene Aliases
Gene description & Other designations Description:   beta-galactosidase 17      Other designations:   beta-galactosidase 17
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   plus     Exon count:   19
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 3353885 ...... 3361833
CDS Sequence 103327697
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Di     Repeat sequence: (TC)5
Repeat start & end within CDS Repeat start: 102     Repeat end: 111
Forward primer Primer sequence:   TGTCAAGCTCCAAGTGGTCA     Tm(°C): 59.163     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CAGGAAGGAGCTGCTGTTGA     Tm(°C): 59.964     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 31     End: 201     Product size (bp): 171
JBrowse View      JBrowse

Enzyme Id:  K12309
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103327697     NCBI Gene Symbol: LOC103327697
Gene Aliases
Gene description & Other designations Description:   beta-galactosidase 17      Other designations:   beta-galactosidase 17
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   plus     Exon count:   19
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 3353885 ...... 3361833
CDS Sequence 103327697
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (CCATCA)2
Repeat start & end within CDS Repeat start: 174     Repeat end: 185
Forward primer Primer sequence:   TGTCCCTGTCTTCGCTCTTC     Tm(°C): 59.396     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TCCCAATGCCTTTGCTCTCA     Tm(°C): 59.595     GC (%): 50     Size: 20
Primer start, end within sequence and product size Start: 128     End: 362     Product size (bp): 235
JBrowse View      JBrowse

Enzyme Id:  K12309
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103327697     NCBI Gene Symbol: LOC103327697
Gene Aliases
Gene description & Other designations Description:   beta-galactosidase 17      Other designations:   beta-galactosidase 17
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   plus     Exon count:   19
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 3353885 ...... 3361833
CDS Sequence 103327697
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Di     Repeat sequence: (AT)4
Repeat start & end within CDS Repeat start: 507     Repeat end: 514
Forward primer Primer sequence:   TGAGAGCAAAGGCATTGGGA     Tm(°C): 59.595     GC (%): 50     Size: 20
Reverse primer Primer sequence:   GGCTTCCCCACCATCTTTCA     Tm(°C): 59.96     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 343     End: 630     Product size (bp): 288
JBrowse View      JBrowse

Enzyme Id:  K12309
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103327697     NCBI Gene Symbol: LOC103327697
Gene Aliases
Gene description & Other designations Description:   beta-galactosidase 17      Other designations:   beta-galactosidase 17
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   plus     Exon count:   19
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 3353885 ...... 3361833
CDS Sequence 103327697
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (CAC)3
Repeat start & end within CDS Repeat start: 932     Repeat end: 940
Forward primer Primer sequence:   GAGTTCAATGCCCCAGGGAA     Tm(°C): 59.96     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AGTCTGCGCATTCTTCTCCC     Tm(°C): 60.108     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 909     End: 998     Product size (bp): 90
JBrowse View      JBrowse

Enzyme Id:  K12309
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103327697     NCBI Gene Symbol: LOC103327697
Gene Aliases
Gene description & Other designations Description:   beta-galactosidase 17      Other designations:   beta-galactosidase 17
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   plus     Exon count:   19
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 3353885 ...... 3361833
CDS Sequence 103327697
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (TATGAT)2
Repeat start & end within CDS Repeat start: 1153     Repeat end: 1164
Forward primer Primer sequence:   GGGAGAAGAATGCGCAGACT     Tm(°C): 60.108     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CGATGGAACTGCAGGGAGAG     Tm(°C): 60.179     GC (%): 60     Size: 20
Primer start, end within sequence and product size Start: 979     End: 1265     Product size (bp): 287
JBrowse View      JBrowse

Enzyme Id:  K12309
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103327697     NCBI Gene Symbol: LOC103327697
Gene Aliases
Gene description & Other designations Description:   beta-galactosidase 17      Other designations:   beta-galactosidase 17
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   plus     Exon count:   19
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 3353885 ...... 3361833
CDS Sequence 103327697
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Hexa     Repeat sequence: (CAATCC)2
Repeat start & end within CDS Repeat start: 1764     Repeat end: 1775
Forward primer Primer sequence:   CAACCTGAACGAATCCCCCA     Tm(°C): 59.962     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CTTTACCCCACCCGCTCAAT     Tm(°C): 60.034     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1739     End: 1944     Product size (bp): 206
JBrowse View      JBrowse

Enzyme Id:  K12309
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   103327697     NCBI Gene Symbol: LOC103327697
Gene Aliases
Gene description & Other designations Description:   beta-galactosidase 17      Other designations:   beta-galactosidase 17
Chromosome, Strand & Exon count Chromosome:   LG4     Strand:   plus     Exon count:   19
Gene Location within genomic sequence Genomic accession No. NC_024129.1      Gene Start and end within genomic accession: 3353885 ...... 3361833
CDS Sequence 103327697
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   ATTGAGCGGGTGGGGTAAAG     Tm(°C): 60.034     GC (%): 55     Size: 20
Reverse primer Primer sequence:   AACTGTACCACAAGCTCCGG     Tm(°C): 59.965     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 1925     End: 2101     Product size (bp): 177
JBrowse View      JBrowse