Statistics
Number of enzymes: 1
Total Number of designed primers: 2
Number of PGTM primers: 1
Number of PMTM primers: 1
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: PHAVU_005G022200g NCBI Gene Symbol: PHAVU_005G022200g |
| Gene Aliases | PHAVU_005G022200g |
| Gene description & Other designations | Description: hypothetical protein Other designations: hypothetical protein |
| Chromosome, Strand & Exon count | Chromosome: 5 Strand: minus Exon count: 13 |
| Gene Location within genomic sequence | Genomic accession No. NC_023755.1 Gene Start and end within genomic accession: 1977687 ...... 1982254 |
| CDS Sequence | PHAVU_005G022200g |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Penta Repeat sequence: (GGATG)2 |
| Repeat start & end within CDS | Repeat start: 702 Repeat end: 711 |
| Forward primer | Primer sequence: ATGGTGTCTTGCTGTCCCTG Tm(°C): 59.963 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: ACAGGATCGGCTTCAACTGG Tm(°C): 60.036 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 531 End: 850 Product size (bp): 320 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: PHAVU_005G022200g NCBI Gene Symbol: PHAVU_005G022200g |
| Gene Aliases | PHAVU_005G022200g |
| Gene description & Other designations | Description: hypothetical protein Other designations: hypothetical protein |
| Chromosome, Strand & Exon count | Chromosome: 5 Strand: minus Exon count: 13 |
| Gene Location within genomic sequence | Genomic accession No. NC_023755.1 Gene Start and end within genomic accession: 1977687 ...... 1982254 |
| CDS Sequence | PHAVU_005G022200g |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: TTCACGCTCCTCATCCCCTA Tm(°C): 60.033 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: AAAGGGGTGAAAGCGATCGT Tm(°C): 59.964 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 135 End: 257 Product size (bp): 123 |
| JBrowse View | JBrowse |
