|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: PHAVU_005G174900g NCBI Gene Symbol: PHAVU_005G174900g |
| Gene Aliases | PHAVU_005G174900g |
| Gene description & Other designations | Description: hypothetical protein Other designations: hypothetical protein |
| Chromosome, Strand & Exon count | Chromosome: 5 Strand: plus Exon count: 10 |
| Gene Location within genomic sequence | Genomic accession No. NC_023755.1 Gene Start and end within genomic accession: 39837998 ...... 39842544 |
| CDS Sequence | PHAVU_005G174900g |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Hexa Repeat sequence: (TATTGA)2 |
| Repeat start & end within CDS | Repeat start: 510 Repeat end: 521 |
| Forward primer | Primer sequence: GCACCCGCACATTACAGTTC Tm(°C): 59.832 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: TCCTGCACAGAGTTCTCTGC Tm(°C): 59.68 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 290 End: 592 Product size (bp): 303 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: PHAVU_005G174900g NCBI Gene Symbol: PHAVU_005G174900g |
| Gene Aliases | PHAVU_005G174900g |
| Gene description & Other designations | Description: hypothetical protein Other designations: hypothetical protein |
| Chromosome, Strand & Exon count | Chromosome: 5 Strand: plus Exon count: 10 |
| Gene Location within genomic sequence | Genomic accession No. NC_023755.1 Gene Start and end within genomic accession: 39837998 ...... 39842544 |
| CDS Sequence | PHAVU_005G174900g |
| Marker Information | |
| Marker Type | PMTM |
| Repeat type & sequence | Repeat type: Hexa Repeat sequence: (GTTGAT)2 |
| Repeat start & end within CDS | Repeat start: 709 Repeat end: 720 |
| Forward primer | Primer sequence: GGGGAGATCAGACTTGGGGA Tm(°C): 60.327 GC (%): 60 Size: 20 |
| Reverse primer | Primer sequence: TGAACGATGCATGGCCTCTT Tm(°C): 60.035 GC (%): 50 Size: 20 |
| Primer start, end within sequence and product size | Start: 632 End: 764 Product size (bp): 133 |
| JBrowse View | JBrowse |
|
| Gene Information | |
| NCBI Gene Accession Number & Symbol | Accession Number: PHAVU_005G174900g NCBI Gene Symbol: PHAVU_005G174900g |
| Gene Aliases | PHAVU_005G174900g |
| Gene description & Other designations | Description: hypothetical protein Other designations: hypothetical protein |
| Chromosome, Strand & Exon count | Chromosome: 5 Strand: plus Exon count: 10 |
| Gene Location within genomic sequence | Genomic accession No. NC_023755.1 Gene Start and end within genomic accession: 39837998 ...... 39842544 |
| CDS Sequence | PHAVU_005G174900g |
| Marker Information | |
| Marker Type | PGTM |
| Repeat type & sequence | Repeat type: Repeat sequence: |
| Repeat start & end within CDS | Repeat start: Repeat end: |
| Forward primer | Primer sequence: GTGTGGTTGAGTTGCGTCAC Tm(°C): 59.972 GC (%): 55 Size: 20 |
| Reverse primer | Primer sequence: GGTGGTCATTCTGTCAGCCA Tm(°C): 59.963 GC (%): 55 Size: 20 |
| Primer start, end within sequence and product size | Start: 33 End: 248 Product size (bp): 216 |
| JBrowse View | JBrowse |
