image


Statistics

Number of enzymes: 1
Total Number of designed primers: 8
Number of PGTM primers:     4
Number of PMTM primers:     4

Enzyme Id:  K11778
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111470589     NCBI Gene Symbol: LOC111470589
Gene Aliases
Gene description & Other designations Description:   dehydrodolichyl diphosphate synthase 6      Other designations:   dehydrodolichyl diphosphate synthase 6
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111470589
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (ACTTC)2
Repeat start & end within CDS Repeat start: 390     Repeat end: 399
Forward primer Primer sequence:   CGTGACGATCTACGCCTTCA     Tm(°C): 59.902     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCTGACGGGTTCACTCAACA     Tm(°C): 59.894     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 254     End: 434     Product size (bp): 181
JBrowse View      JBrowse

Enzyme Id:  K11778
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111470589     NCBI Gene Symbol: LOC111470589
Gene Aliases
Gene description & Other designations Description:   dehydrodolichyl diphosphate synthase 6      Other designations:   dehydrodolichyl diphosphate synthase 6
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111470589
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Penta     Repeat sequence: (GATGA)2
Repeat start & end within CDS Repeat start: 562     Repeat end: 571
Forward primer Primer sequence:   TGTTGAGTGAACCCGTCAGG     Tm(°C): 59.894     GC (%): 55     Size: 20
Reverse primer Primer sequence:   TCTCCAGACGTGCGGATTAG     Tm(°C): 59.261     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 415     End: 724     Product size (bp): 310
JBrowse View      JBrowse

Enzyme Id:  K11778
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111470589     NCBI Gene Symbol: LOC111470589
Gene Aliases
Gene description & Other designations Description:   dehydrodolichyl diphosphate synthase 6      Other designations:   dehydrodolichyl diphosphate synthase 6
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111470589
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   CGTGACGATCTACGCCTTCA     Tm(°C): 59.902     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCTGACGGGTTCACTCAACA     Tm(°C): 59.894     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 254     End: 434     Product size (bp): 181
JBrowse View      JBrowse

Enzyme Id:  K11778
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111484510     NCBI Gene Symbol: LOC111484510
Gene Aliases
Gene description & Other designations Description:   dehydrodolichyl diphosphate synthase 2      Other designations:   dehydrodolichyl diphosphate synthase 2
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111484510
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (TTC)3
Repeat start & end within CDS Repeat start: 790     Repeat end: 798
Forward primer Primer sequence:   GCGAACTCCGAATCAGCAAC     Tm(°C): 59.905     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GAAACCAGAGCCTCCACGAA     Tm(°C): 59.965     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 739     End: 853     Product size (bp): 115
JBrowse View      JBrowse

Enzyme Id:  K11778
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111484510     NCBI Gene Symbol: LOC111484510
Gene Aliases
Gene description & Other designations Description:   dehydrodolichyl diphosphate synthase 2      Other designations:   dehydrodolichyl diphosphate synthase 2
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111484510
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   GCGAACTCCGAATCAGCAAC     Tm(°C): 59.905     GC (%): 55     Size: 20
Reverse primer Primer sequence:   GAAACCAGAGCCTCCACGAA     Tm(°C): 59.965     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 739     End: 853     Product size (bp): 115
JBrowse View      JBrowse

Enzyme Id:  K11778
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111499983     NCBI Gene Symbol: LOC111499983
Gene Aliases
Gene description & Other designations Description:   dehydrodolichyl diphosphate synthase complex subunit nus1-like      Other designations:   dehydrodolichyl diphosphate synthase complex subunit nus1-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111499983
Marker Information
Marker Type PMTM
Repeat type & sequence Repeat type: Tri     Repeat sequence: (TTG)3
Repeat start & end within CDS Repeat start: 194     Repeat end: 202
Forward primer Primer sequence:   GCCACGACACTCGAAAGCTA     Tm(°C): 60.388     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CTTCCTTTCCATCCGACGCT     Tm(°C): 60.108     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 105     End: 435     Product size (bp): 331
JBrowse View      JBrowse

Enzyme Id:  K11778
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111499983     NCBI Gene Symbol: LOC111499983
Gene Aliases
Gene description & Other designations Description:   dehydrodolichyl diphosphate synthase complex subunit nus1-like      Other designations:   dehydrodolichyl diphosphate synthase complex subunit nus1-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111499983
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   AGCGTCGGATGGAAAGGAAG     Tm(°C): 60.108     GC (%): 55     Size: 20
Reverse primer Primer sequence:   CCCTCCACATCCAACTGCTT     Tm(°C): 59.961     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 416     End: 563     Product size (bp): 148
JBrowse View      JBrowse

Enzyme Id:  K11778
Gene Information
NCBI Gene Accession Number & Symbol Accession Number:   111484292     NCBI Gene Symbol: LOC111484292
Gene Aliases
Gene description & Other designations Description:   dehydrodolichyl diphosphate synthase complex subunit nus1-like      Other designations:   dehydrodolichyl diphosphate synthase complex subunit nus1-like
Chromosome, Strand & Exon count Chromosome:   Un     Strand:        Exon count:   
Gene Location within genomic sequence Genomic accession No.      Gene Start and end within genomic accession: ......
CDS Sequence 111484292
Marker Information
Marker Type PGTM
Repeat type & sequence Repeat type:      Repeat sequence:
Repeat start & end within CDS Repeat start:      Repeat end:
Forward primer Primer sequence:   TGGTTAGCATCGTTGGGCAT     Tm(°C): 60.035     GC (%): 50     Size: 20
Reverse primer Primer sequence:   CCTGAAACACCGACGCATTG     Tm(°C): 60.11     GC (%): 55     Size: 20
Primer start, end within sequence and product size Start: 249     End: 360     Product size (bp): 112
JBrowse View      JBrowse